Can Irrationality in Mathematics Be Explained by Genetic Sequences as in the Square Root of Ten?

One of the irrational numbers is the square root of ten number. This article researches whether there is a link between the square root of ten number and the genetic sequences. At first, the square root digits of the number ten after the comma are summed one by one. Secondly, the result of the addition corresponds to the nucleotide bases. Thirdly the results thus obtained are expressed as nucleotide bases (A, T, C and G). (A) Adenine, (T) Thymine, (C) Cytosine and (G) Guanine. From this point of view, approximately when the first four hundred digits of the square root of the number ten after the comma are calculated, the resulting gene sequencing is as follows: [ATAAGTCATAAGTGTATTAGTTTAAAACTG]. Fourthly, at this time, some repetitions were detected exactly like this: as “AGT” and “ATA”. Fifthly, after searching this sequence in NCBI (National Biotechnology Information Center), the search result was similar to bony fish, especially Danio aesculapii. Lastly, Danio aesculapii species is closely related to Zebra fish. In summary, With these results, not only the square root of ten in mathematics, but also many other irrational numbers (as explained by the similar QUANTUM PERSPECTIVE MODEL in previous articles), adding a common perspective to these different sciences; the connection between genetic codes in biochemistry and irrational numbers in mathematics is meaningful and has revealed very valuable results. In other words, with this novel research, a new window has been opened that can lead to new interdisciplinary discoveries.