全部 标题 作者
关键词 摘要

OALib Journal期刊
ISSN: 2333-9721
费用:99美元

查看量下载量

Can Irrationality in Mathematics Be Explained by Genetic Sequences as in the Square Root of Ten?

DOI: 10.4236/oalib.1108504, PP. 1-9

Subject Areas: Biochemistry, Mathematics, Number Theory

Keywords: Quantum Perspective Model, Danio Kyathit, Danio aesculapii, The Square Roots of Ten and NCBI (National Biotechnology Information Center)

Full-Text   Cite this paper   Add to My Lib

Abstract

One of the irrational numbers is the square root of ten number. This article researches whether there is a link between the square root of ten number and the genetic sequences. At first, the square root digits of the number ten after the comma are summed one by one. Secondly, the result of the addition corresponds to the nucleotide bases. Thirdly the results thus obtained are expressed as nucleotide bases (A, T, C and G). (A) Adenine, (T) Thymine, (C) Cytosine and (G) Guanine. From this point of view, approximately when the first four hundred digits of the square root of the number ten after the comma are calculated, the resulting gene sequencing is as follows: [ATAAGTCATAAGTGTATTAGTTTAAAACTG]. Fourthly, at this time, some repetitions were detected exactly like this: as “AGT” and “ATA”. Fifthly, after searching this sequence in NCBI (National Biotechnology Information Center), the search result was similar to bony fish, especially Danio aesculapii. Lastly, Danio aesculapii species is closely related to Zebra fish. In summary, With these results, not only the square root of ten in mathematics, but also many other irrational numbers (as explained by the similar QUANTUM PERSPECTIVE MODEL in previous articles), adding a common perspective to these different sciences; the connection between genetic codes in biochemistry and irrational numbers in mathematics is meaningful and has revealed very valuable results. In other words, with this novel research, a new window has been opened that can lead to new interdisciplinary discoveries.

Cite this paper

Olmez, T. (2022). Can Irrationality in Mathematics Be Explained by Genetic Sequences as in the Square Root of Ten?. Open Access Library Journal, 9, e08504. doi: http://dx.doi.org/10.4236/oalib.1108504.

References

[1]  Köklü, K. (2019) Is Relativity Theory Also Valid in Biogenetics and Mathematics? NeuroQuantology, 17, 53-58. https://doi.org/10.14704/nq.2019.17.3.1999
[2]  Köklü, K. (2019) A Quantum Perspective Model to Genetic Codes through Various Sciences. NeuroQuantology, 17, 15-18. https://doi.org/10.14704/nq.2019.17.3.1974
[3]  Ölmez, T. (2021) According to Quantum Perspective Model, Are the Numbers of Pi Also Meaningful in Biochemistry? International Journal of Natural Sciences: Current and Future Research Trends (IJNSCFRT), 11, 1-10.
[4]  Ölmez, T. (2020) Is There an Aesthetics in Golden Ratio as Regards to the Common Cis-Regulatory Elements versus to Atomic Numbers of Elements with Respect to Quantum Perspective Model? Neurology and Neuroscience Reports, 3, 1-4. https://doi.org/10.15761/NNR.1000119
[5]  Ölmez, T. (2020) With Respect to Quantum Perspective Model, Can Euler Numbers Be Related to Biochemistry? Global Journal of Science Frontier Research, 20, 7-14. https://doi.org/10.34257/GJSFRFVOL20IS9PG7
[6]  Ölmez, T. (2021) According to the Binary Number Base System, Are the Square Roots of Two Numbers also Significant in Biochemistry? Open Access Library Journal, 8, e7122. https://doi.org/10.4236/oalib.1107122
[7]  Ölmez, T. (2021) What Is the Meaning of the Square Root of the Number Three in Biochemistry? Open Access Library Journal, 8, e7123. https://doi.org/10.4236/oalib.1107123
[8]  Ölmez, T. (2021) Can Irrational Numbers (Such as Square Root of the Number Five) Be Reached by Analysis of Genetic Sequences? Open Access Library Journal, 8, e7104. https://doi.org/10.4236/oalib.1107104
[9]  Ölmez, T. (2022) Are Irrational Numbers (Like the Square Root of the Number Seven) Applicable to Genetic Sequences? Open Access Library Journal, 9, e8513. https://doi.org/10.4236/oalib.1108513
[10]  Ölmez, T. (2020) Is There a Similarity between Fibonacci Sequence and Euler’s Number with Respect to Quantum Perspective Model? Global Journal of Science Frontier Research, 20, 35-39. https://doi.org/10.34257/GJSFRFVOL20IS9PG35
[11]  Wieser, E.M., Holden, N., Coplen, B.T., Böhlke, J.K., Berglund, M., Brand, W.A., et al. (2013) Atomic Weights of the Elements 2011 (IUPAC Technical Report). Pure and Application Chemistry, 85, 1047-1078. https://doi.org/10.1351/PAC-REP-13-03-02
[12]  Lodish, H., Berk, A., Zipursky, S.L., Matsudaira, P., Baltimore, D. and Darnell, J. (2018) Molecular Cell Biology, 6th Edition, Translation: Geçkil, H., Özmen, M. and Yesilada, Ö., Palme Publishing, New York, 294-302.
[13]  Ölmez, T. (2021) According to Quantum Perspective Model, Is Euler’s Identity also Meaningful in Biochemistry? International Journal of Natural Sciences: Current and Future Research Trends, 9, 23-28.
[14]  https://en.wikipedia.org/wiki/DNA_and_RNA_codon_tables#Standard_DNA_codon_table
[15]  https://apod.nasa.gov/htmltest/gifcity/sqrt10.1mil
[16]  Fuhrmann, A., Getfert, S., Fu, Q., Reimann, P., Lindsay, S. and Ros, R. (2012) Long Lifetime of Hydrogen-Bonded DNA Basepairs by Force Spectroscopy. Biophysical Journal, 102, 2381-2390. https://doi.org/10.1016/j.bpj.2012.04.006 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3353008/
[17]  Farrell, R.E. (2010) RNA Methodologies A Laboratory Guide for Isolation and Characterization. 4th Edition, Academic Press, Amsterdam, 704-710.
[18]  Penrose, S.R., Abbott, D., Davies, P.C.W. and Pati, A.K. (Eds.) (2008) Quantum Aspects of Life. Imperial College Press, London, 20-29.
[19]  https://en.wikipedia.org/wiki/Danio_kyathi
[20]  https://en.wikipedia.org/wiki/Zebrafish
[21]  Kullander, S.O. and Fang, F. (2009) Danio aesculapii, a New Species of Danio from South-Western Myanmar. Zootaxa, 2164, 41-48. https://doi.org/10.11646/zootaxa.2164.1.4
[22]  https://en.wikipedia.org/wiki/Panther_danio
[23]  https://blast.ncbi.nlm.nih.gov/Blast.cgi

Full-Text


Contact Us

service@oalib.com

QQ:3279437679

WhatsApp +8615387084133