According to Quantum Perspective Model, this article researches whether there is a link between the square root of three numbers and the genetic codes. At first, when the digits of the square root of three numbers [1] after the comma are converted from decimal (10) number base system to binary (2) number base system, it corresponds to nucleotide bases. Secondly, the results obtained by this way are expressed as nucleotide bases (A, T, C, G, and U), (A) Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, when the first three hundred and sixty digits of the square root of the two numbers after the comma are calculated, the gene sequence is obtained as follows: [GGATGACTACGGGTTTAGAAA]. Thirdly, the search result is similar to DENTICLE HERRING, after the NCBI (National Biotechnology Information Center) searched this sequence. Fourthly, the genetic codes of bony fish were found to be similar to human genetic codes. In summary, with these results, the link between the square root of three in mathematical science and the genetic codes in biochemistry was determined.
Cite this paper
Olmez, T. (2021). What Is the Meaning of the Square Root of the Number Three in Biochemistry?. Open Access Library Journal, 8, e7123. doi: http://dx.doi.org/10.4236/oalib.1107123.
Köklü, K. (2019) Is Relativity Theory Also Valid in Biogenetics and Mathematics? NeuroQuantology, 17, 53-58. https://doi.org/10.14704/nq.2019.17.3.1999
Ölmez, T. (2020) Is There an Aesthetics in Golden Ratio as Regards to the Common Cis-Regulatory Elements versus to Atomic Numbers of Elements with Respect to Quantum Perspective Model? Neurology and Neuroscience Reports, 3, 1-4.
Köklü, K. (2019) A Quantum Perspective Model to Genetic Codes through Various Sciences. NeuroQuantology, 17, 15-18. https://doi.org/10.14704/nq.2019.17.3.1974
Wieser, E.M., Holden, N., Coplen, B.T., Böhlke, J.K., Berglund, M., Brand, W.A., et al. (2013) Atomic Weights of the Elements 2011. Pure and Application Chemistry, 85, 1047-1078. https://doi.org/10.1351/PAC-REP-13-03-02
Lodish, H., Berk, A., Zipursky, S.L., Matsudaira, P., Baltimore, D. and Darnell, J. (2018) Molecular Cell Biology. 6th Edition, Translation: Geçkil, H., Özmen, M., Yeşilada, Ö., Palme Publishing, New York, 294-302.
Ölmez, T. (2021) Is There a Similarity between Fibonacci Sequence and Euler’s Number with Respect to Quantum Perspective Model? Global Journal of Science Frontier Research, 20, 33. https://doi.org/10.34257/GJSFRFVOL20IS9PG35
Ölmez, T. (2021) With Respect to Quantum Perspective Model, Can Euler Numbers Be Related to Biochemistry? Global Journal of Science Frontier Research, 20, 7-14.
https://doi.org/10.34257/GJSFRFVOL20IS9PG7
Hill, J., et al. (2019) Recurrent Convergent Evolution at Amino Acid Residue 261 in Fish Rhodopsin. PNAS, 116, 18473-18478.
https://www.pnas.org/content/116/37/18473
