Erratum

In the article by Maurya et Mishra, entitled “Pax6 Binds to Promoter Sequence Elements Associated with Immunological Surveillance and Energy Homeostasis in Brain of Aging Mice” [Ann Neurosci 2017; 24: 20–25, DOI: 10.1159/000464419], the wrong primer sequence of Sparc was added in Table 1 of the article. SparcF-5′ATGAGGGCCTGGATCTTCTTT3′ should read SparcR-5′GGAAGAGTCGAAGGTCTTGTTGTC3′ and the Accession number should read {"type":"entrez-nucleotide","attrs":{"text":"KT314218","term_id":"922668174","term_text":"KT314218"}}KT314218 in the Result section