%0 Journal Article
%T Erratum
%J Archive of "Annals of Neurosciences".
%D 2019
%R 10.1159/000487177
%X In the article by Maurya et Mishra, entitled ¡°Pax6 Binds to Promoter Sequence Elements Associated with Immunological Surveillance and Energy Homeostasis in Brain of Aging Mice¡± [Ann Neurosci 2017; 24: 20¨C25, DOI: 10.1159/000464419], the wrong primer sequence of Sparc was added in Table 1 of the article. SparcF-5¡äATGAGGGCCTGGATCTTCTTT3¡ä should read SparcR-5¡äGGAAGAGTCGAAGGTCTTGTTGTC3¡ä and the Accession number should read {"type":"entrez-nucleotide","attrs":{"text":"KT314218","term_id":"922668174","term_text":"KT314218"}}KT314218 in the Result section
%U https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6388546/