Irrational numbers didn’t have reoccurrence sequence but this paper calculated a sequence with respect to Quantum Perspective Model. One of the irrational numbers is the square root of five numbers. This article researches whether there is a link between the square root of five numbers and the genetic sequences. At first, the square root digits of the number five after the comma are added respectively. Secondly, the resulting sum corresponds to the nucleotide bases, the results obtained in this way are expressed as nucleotide bases (A, T, C, G, and U): (A) Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, when the first three hundred digits of the square root of the number five after the comma are calculated, the gene sequence is obtained as follows: [ATTTATTCAATACATAACCCCATTGA]. Thirdly, in this sequence, some of reoccurrences were detected just like as “CAT” and “ATT”. Fourthly, after researching this sequence at NCBI (National Biotechnology Information Center), the search result is similar to bony fishes, especially DANIO RERIO (Zebra fish). Lastly, the genetic codes of Zebra fishes were found to be similar to human genetic codes. In summary, the connection between these results and the square root of the five in mathematical science and the genetic codes in biochemistry may shed light on explaining irrational numbers.
Köklü, K. (2019) A Quantum Perspective Model to Genetic Codes through Various Sciences. NeuroQuantology, 17, 15-18. https://doi.org/10.14704/nq.2019.17.3.1974
[4]
Ölmez, T. (2020) Is There an Aesthetics in Golden Ratio as Regards to the Common Cis-Regulatory Elements versus to Atomic Numbers of Elements with Respect to Quantum Perspective Model? Neurology and Neuroscience Reports, 3, 1-4.
[5]
Ölmez, T. (2021) With Respect to Quantum Perspective Model, Can Euler Numbers Be Related to Biochemistry? Global Journal of Science Frontier Research, 20, 7-14.
https://doi.org/10.34257/GJSFRFVOL20IS9PG7
[6]
Ölmez, T. (2020) According to the Binary Number Base System, Does the Square Root of the Number Two Mean in Biochemistry?
[7]
Ölmez, T. (2020) What Is the Meaning of the Square Root of the Number Three in Biochemistry?
[8]
Wieser, E.M., Holden, N., Coplen, B.T., Böhlke, J.K., Berglund, M., Brand, W.A., et al. (2013) Atomic Weights of the Elements 2011. Pure and Application Chemistry, 85, 1047-1078. https://doi.org/10.1351/PAC-REP-13-03-02
[9]
Lodish, H., Berk, A., Zipursky, S.L., Matsudaira, P., Baltimore, D. and Darnell, J. (2018) Molecular Cell Biology. 6th Edition, Translation: Geçkil, H., Özmen, M., Yeşilada, Ö., Palme Publishing, New York, 294-302.
[10]
Nirenberg, M., Leder, P., Bernfield, M., Brimacombe, R., Trupin, J., Rottman, F. and O’Neal, C. (1965) RNA Codewords and Protein Synthesis, VII. On the General Nature of the RNA Code. Proceedings of the National Academy of Sciences of the United States of America, 53, 1161-1168. https://doi.org/10.1073/pnas.53.5.1161
[11]
Ölmez, T. (2021) Is There a Similarity between Fibonacci Sequence and Euler’s Number with Respect to Quantum Perspective Model? Global Journal of Science Frontier Research, 20, 33. https://doi.org/10.34257/GJSFRFVOL20IS9PG35
[12]
Farrell, R.E. (2010) RNA Methodologies A Laboratory Guide for Isolation and Characterization. 4th Edition, Elsevier Academic Press, Amsterdam, 704-710.
[13]
https://blast.ncbi.nlm.nih.gov/Blast.cgi
[14]
https://en.wikipedia.org/wiki/Zebrafish
[15]
Köklü, K. (2019) Is Relativity Theory Also Valid in Biogenetics and Mathematics? NeuroQuantology, 17, 53-58. https://doi.org/10.14704/nq.2019.17.3.1999
[16]
Stewart, I. (1999) Life’s Other Secret: The New Mathematics of the Living World. Penguin, New York.
[17]
Petoukhov, S.V. (2011) Matrix Genetics and Algebraic Properties of the Multi-Level System of Genetic Alphabets. NeuroQuantology, 9, 60-81.
https://doi.org/10.14704/nq.2011.9.4.501