Mycoplasma hominis is a fastidious micro-organism causing genital and extragenital infections. We developed a specific real-time PCR that exhibits high sensitivity and low intrarun and interrun variabilities. When applied to clinical samples, this quantitative PCR allowed to confirm the role of M. hominis in three patients with severe extragenital infections. Mycoplasma hominis are fastidious bacteria, which are not detected on routinely used axenic media [1]. Lack of a cell wall makes these organisms naturally resistant to -lactam antibiotics and not detectable by Gram staining. M. hominis is a recognized agent of genital infections in adults as well as of neonatal infections [2, 3]. Furthermore, it has been reported as the etiologic agent of various serious extra-genital infections such as brain abscess, pneumonia, mediastinitis, pericarditis, endocarditis, osteitis, arthritis, wound infections, peritonitis, and pyelonephritis both in immunosuppressed and in immunocompetent individuals [4–11]. Since most commonly used antibiotics in clinical practice are not active against M. hominis, the diagnosis of infections due to this fastidious bacterium is a crucial issue, especially for extra-genital cases. In this context, we developed a real-time PCR assay for the detection of M. hominis. Then, this new PCR was applied to clinical samples obtained from patients suffering from extra-genital M. hominis infections. A forward primer MhF (5-TTTGGTCAAGTCCTGCAACGA-3’, position 2472–2493 of GenBank sequence AF443616), a reverse primer MhR (5’-CCCCACCTTCCTCCCAGTTA-3’, position 2553–2572 of AF443616), which amplifies a 101？bp part of the 16S rRNA-encoding gene, and a minor-groove binder probe labeled with 5’ VIC (TACTAACATTAAGTTGAGGACTCTA, position 2513–2537 of AF443616) were selected using the Primer Express software (Applied Biosystems, Darmstadt, Germany). The reactions were performed in a final volume of 20？ l, including 0.2？ M of each primer, 0.2. M of probe, 10？ l 2 TaqMan Universal Master Mix (Applied Biosystems), and 5？ l of DNA sample. The cycling conditions were 2？min at 50°C and 10？min at 95°C, followed by 45 cycles of 15？s at 95°C and 1？min at 60°C. An ABI Prism 7900 instrument (Applied Biosystems) was used for the amplification and detection of the PCR products. The specificity of the real-time PCR was high, being increased by the use of a TaqMan probe. No cross-amplification was observed when 5？ng of genomic DNA of humans, fungus (Candida albicans ATCC 10231), and 15 different bacterial strains were tested (Mycoplasma pneumoniae, Ureaplasma parvum,
References
[1]
K. B. Waites and T. Robinson, “Mycoplasma and ureaplasma,” in Manual of Clinical Microbiology, P. R. Murray, Ed., pp. 1004–1020, ASM Press, Washington, DC, USA, 2007.
[2]
P. Taylor, “Medical significance of mycoplasmas,” Methods in Molecular Biology, vol. 104, pp. 7–15, 1998.
[3]
K. B. Waites, B. Katz, and R. L. Schelonka, “Mycoplasmas and ureaplasmas as neonatal pathogens,” Clinical Microbiology Reviews, vol. 18, no. 4, pp. 757–789, 2005.
[4]
M. A. Masalma, F. Armougom, W. M. Scheld, H. Dufour, P.-H. Roche, M. Drancourt, and D. Raoult, “The expansion of the microbiological spectrum of brain abscesses with use of multiple 16S ribosomal DNA sequencing,” Clinical Infectious Diseases, vol. 48, no. 9, pp. 1169–1178, 2009.
[5]
F. Fenollar, V. Gauduchon, J. P. Casalta, H. Lepidi, F. Vandenesch, and D. Raoult, “Mycoplasma endocarditis: two case reports and a review,” Clinical Infectious Diseases, vol. 38, no. 3, pp. e21–e24, 2004.
[6]
C. García, E. Ugalde, I. Monteagudo, A. Saez, J. Agüero, L. Martinez-Martinez, and E. Mi？ambres, “Isolation of Mycoplasma hominis in critically ill patients with pulmonary infections: clinical and microbiological analysis in an intensive care unit,” Intensive Care Medicine, vol. 33, no. 1, pp. 143–147, 2007.
[7]
G. M. Lyon, J. A. Alspaugh, F. T. Meredith, L. J. Harrell, V. Tapson, R. D. Davis, and S. S. Kanj, “Mycoplasma hominis pneumonia complicating bilateral lung transplantation: case report and review of the literature,” Chest, vol. 112, no. 5, pp. 1428–1432, 1997.
[8]
H. Marini, V. Merle, and V. Merle, “Mycoplasma hominis wound infection after a vascular allograft,” Journal of Infection, vol. 57, no. 3, pp. 272–274, 2008.
[9]
F. Mechai, G. Le Moal, S. Duchêne, C. Burucoa, C. Godet, and M. Freslon, “Mycoplasma hominis osteitis in an immunocompetent man,” European Journal of Clinical Microbiology and Infectious Diseases, vol. 25, no. 11, pp. 715–717, 2006.
[10]
R. Norton and L. Mollison, “Mycoplasma hominis pneumonia in Aboriginal adults,” Pathology, vol. 27, no. 1, pp. 58–60, 1995.
[11]
S. S.-Y. Wong and K.-Y. Yuen, “Acute pyelonephritis caused by Mycoplasma hominis,” Pathology, vol. 27, no. 1, pp. 61–63, 1995.
[12]
K. Jaton, J. Bille, and G. Greub, “A novel real-time PCR to detect Chlamydia trachomatis in first-void urine or genital swabs,” Journal of Medical Microbiology, vol. 55, no. 12, pp. 1667–1674, 2006.
[13]
C. Petti, P. Bosshard, M. Brandt, et al., “Interpretative criteria for identification of bacteria and fungi by DNA target sequencing,” Approved Guideline, vol. 28, no. 12, 2008.
[14]
A. Baczynska, H. F. Svenstrup, J. Fedder, S. Birkelund, and G. Christiansen, “Development of real-time PCR for detection of Mycoplasma hominis,” BMC Microbiology, vol. 4, article no. 35, 2004.
[15]
P. P. Bosshard, A. Kronenberg, R. Zbinden, C. Ruef, E. C. B？ttger, and M. Altwegg, “Etiologic diagnosis of infective endocarditis by broad-range polymerase chain reaction: a 3-year experience,” Clinical Infectious Diseases, vol. 37, no. 2, pp. 167–172, 2003.
[16]
D. Goldenberger, A. Künzli, P. Vogt, R. Zbinden, and M. Altwegg, “Molecular diagnosis of bacterial endocarditis by broad-range PCR amplification and direct sequencing,” Journal of Clinical Microbiology, vol. 35, no. 11, pp. 2733–2739, 1997.
