%0 Journal Article
%T Correction: Kinesin-1 promotes chondrocyte maintenance during skeletal morphogenesis
%J Archive of "PLoS Genetics".
%D 2017
%R 10.1371/journal.pgen.1007099
%X In Table 1, the incorrect primer sequences are shown for bip-F and bip-R. The sequence for bip-F should read bip-F: AGTGATTGGGATCGACCTTG and the sequence for bip-R should read bip-R: AGCTGGATGTGAGGCTTGTT. Please see the corrected Table 1 here
%U https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5687701/