%0 Journal Article
%T RNAi dependent epigenetic marks on a geminivirus promoter
%A Afzal Dogar
%J Virology Journal
%D 2006
%I BioMed Central
%R 10.1186/1743-422x-3-5
%X In plants RNA interference or post transcriptional gene silencing (PTGS) acts as a natural anti-viral defense system for neutralizing pathogenic nucleic acids either through a change in RNA stability in the cytoplasm or through mechanisms that use the RNA itself to induce methylation and silencing of homologous nuclear genes [1]. In addition there are more than one Dicer and Argonaute proteins in plants e.g. Arabidopsis genome encodes four Dicers [2] and ten Argonate orthologs [3]. Geminiviruses are single-stranded circular DNA viruses that cause economically significant diseases in a wide range of crop plants worldwide [4]. They replicate in the plant cell nuclei through transcription and replication competent double stranded DNA intermediate, which is packed into nucleosomes from host cells [5]. In plants, some geminivirus-host interactions naturally lead to host recovery e.g. natural recovery response induced by ACMV-infected N. benthamiana and cassava involves siRNAs originating from geminivirus genome [6]. However the affect of siRNAs at the virus genome remained to be seen. Here I show multiple siRNAs species in transgenic plants direct the methylation of ACMV DNA A as well as the methylation at lysine-9 residues of histone H3 wrapping the promoter region in the virus genome.A 360 nucleotides fragment corresponding to the intergenic region of ACMV DNA A (GenBank: NC_001467) was cloned in sense and anti-sense orientation interrupted with a synthetic plant intron. The left arm KpnI-ClaI and right arm XhoI-BamI fragments were PCR amplifed and cloned into dsproA VMYMV- int vector [7]. The EcoRI-XbaI fragment of this vector was cloned into pCambia 1300. The following primers used for amplification the left arm (KpnI F: GGTACCAATCTCAACTAGAGACACTCTTGA) and (ClaI R: ATCGATGCACAAATATTTAATTGCCAG), and the right arm (XhoI F: CTCGACGCAGTTTATAAATTAACGGGTC) and (BamHI R: GGATCCAATGAGTTGATCTCTGTGAGAACT). The resulting binary construct was introduced into Agrobacterium tumefa
%U http://www.virologyj.com/content/3/1/5