oalib

Publish in OALib Journal

ISSN: 2333-9721

APC: Only $99

Submit

Search Results: 1 - 10 of 13 matches for " Taniawati Supali "
All listed articles are free for downloading (OA Articles)
Page 1 /13
Display every page Item
PENENTUAN KONSENTRASI MINIMAL GEN B1 DAN GEN P30 TOXOPLASMA GONDII YANG MASIH TERDETEKSI DENGAN REAKSI RANTAI POLIMERASE
Lisawati Susanto,Taniawati Supali,Srisasi Gandahusada
Makara Seri Kesehatan , 2002,
Abstract: Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets. The PCR against B1 gene as target was performed by using the method described by Chang & Ho. Two methods described by Weiss et al and Chang & Ho were used against P30 gene as target. The B1 gene primers consisted of oligo 1 :5’GGAACTGCATCCGTTCAGA G3’ and oligo 2 : 5’TCTTTAAAGCGTTCGTGGTC3’, whereas the P30 gene primers consisted of oligo 1 : 5’CACACGGTTGTATGTCGGTTTCG CT3’ and oligo 2 : 5’TCAAGG AGCTCAATGTTACAGCCT3’. It was shown that no specific bands were observed in the PCR with P30 gene as target using the method by Weiss et al. With the method Chang & Ho the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target.
A Longitudinal Study of BCG Vaccination in Early Childhood: The Development of Innate and Adaptive Immune Responses
Yenny Djuardi,Erliyani Sartono,Heri Wibowo,Taniawati Supali,Maria Yazdanbakhsh
PLOS ONE , 2012, DOI: 10.1371/journal.pone.0014066
Abstract: BCG vaccine drives a strong T helper 1 cellular immunity which is essential for the protection against mycobacteria, however recent studies suggest that BCG vaccination can have non-specific beneficial effects unrelated to tuberculosis. In the present cohort study the development of cytokine profiles following BCG vaccination was investigated. Immune responses to PPD were assessed before vaccination and at ages of 5 months, 1 year, and 2 years, followed by BCG scar measurement at 4 years of age. BCG was shown to induce both Th1 and Th2 type responses against PPD at about 5 months of age after vaccination, and while Th1 response was sustained, Th2 responses declined over time. However, BCG scar size was strongly correlated with Th2 responses to PPD at 5 months of age. Importantly, we observed no clear effects of BCG vaccination on innate immune responses in terms of early IL-10 or TNF-α production whereas some alterations in general adaptive immune responses to PHA were observed.
Helminth Infections, Type-2 Immune Response, and Metabolic Syndrome
Aprilianto E. Wiria ,Erliyani Sartono,Taniawati Supali,Maria Yazdanbakhsh
PLOS Pathogens , 2014, DOI: doi/10.1371/journal.ppat.1004140
Abstract:
Impact of Six Rounds of Mass Drug Administration on Brugian Filariasis and Soil-Transmitted Helminth Infections in Eastern Indonesia
Taniawati Supali,Yenny Djuardi,Mark Bradley,Rahmah Noordin,Paul Rückert,Peter U. Fischer
PLOS Neglected Tropical Diseases , 2013, DOI: 10.1371/journal.pntd.0002586
Abstract: Background The lymphatic filarial parasite Brugia timori occurs only in eastern Indonesia where it causes high morbidity. The absence of an animal reservoir, the inefficient transmission by Anopheles mosquitoes and the high sensitivity to DEC/albendazole treatment make this species a prime candidate for elimination by mass drug administration (MDA). Methodology/Principal Findings We evaluated the effect of MDA using DEC and albendazole on B. timori and soil transmitted helminths (STH) in a cross-sectional study of a sentinel village on Alor Island annually over a period of 10 years. Pre-MDA the microfilaria (MF) prevalence was 26% and 80% of the residents had filaria-specific IgG4 antibodies. In 2010, 34 months after the 6th round of MDA, MF and antibody rates were only 0.17% and 6.4%, respectively. The MDA campaign had also a beneficial effect on STH. Baseline prevalence rates for Ascaris, hookworm and Trichuris were 34%, 28%, and 11%, respectively; these rates were reduced to 27%, 4%, and 2% one year after the 5th round of MDA. Unfortunately, STH rates rebounded 34 months after cessation of MDA and approached pre-MDA rates. However, the intensity of STH infection in 2009 was still reduced, and no heavy infections were detected. Conclusions/Significance MDA with DEC/albendazole has had a major impact on B. timori MF and IgG4 antibody rates, providing a proof of principle that elimination is feasible. We also documented the value of annual DEC/albendazole as a mass de-worming intervention and the importance of continuing some form of STH control after cessation of MDA for filariasis.
Determinants of the Relationship between Cytokine Production in Pregnant Women and Their Infants
Yenny Djuardi,Heri Wibowo,Taniawati Supali,Iwan Ariawan,Robbert G. M. Bredius,Maria Yazdanbakhsh,Laura C. Rodrigues,Erliyani Sartono
PLOS ONE , 2012, DOI: 10.1371/journal.pone.0007711
Abstract: Exposure to environmental factors during fetal life and infancy is thought to play an important role in the early development of innate and adaptive immunity. The immunological relationship between mother and infant and the effect that environmental exposures have during pregnancy and early childhood have not been studied extensively. Here the production of cytokines was measured in 146 pairs of mothers and their 2- month-old infants. The effect of place of residence, socio-economic variables, parasitic infections as well as maternal and child characteristics on measured cytokine production was determined. Mothers producing high levels of IL-10, IFN-γ and IL-5 were more likely to have infants who also produced high levels of these cytokines either spontaneously (OR 2.6(95%CI 1.2–5.4), OR 2.9(CI 1.3–6.6), OR 11.2(CI 4.6–27.2), respectively) or in response to PHA (IL-10: OR 3.0(CI 1.4–6.6), IFN-γ: OR 2.0(CI 1.0–4.2), respectively) even after adjustment for potential confounding variables. This was not the case for TNF-α. In response to LPS, place of residence was a strong determinant of infant IL-10 (OR 0.2(CI 0.1–0.9)) and TNF-α (OR 0.3(CI 0.1–0.9)) production. Maternal protozoan infections was independently associated with reduced infant IL10 in response to PHA and to LPS as well as reduced TNF-α and IFN-γ in response to PHA. These results indicate strong relationship between maternal and infant's cellular immune responses even after taking into account many environmental influences that could affect infant's response directly or indirectly through uterine microenvironment. However, place of residence and intestinal infections may still directly affect the immune responses of the infant. Taken together, the study provides evidence for imprinted cytokine responses of an infant which may have implications for their reaction to incoming antigens, warranting further investigation into the role that genetics or epigenetics play in shaping the cytokine response by an infant to self or external antigens.
Regulatory T Cells in Human Lymphatic Filariasis: Stronger Functional Activity in Microfilaremics
Linda J. Wammes ,Firdaus Hamid,Aprilianto E. Wiria,Heri Wibowo,Erliyani Sartono,Rick M. Maizels,Hermelijn H. Smits,Taniawati Supali,Maria Yazdanbakhsh
PLOS Neglected Tropical Diseases , 2012, DOI: 10.1371/journal.pntd.0001655
Abstract: Infection with filarial parasites is associated with T cell hyporesponsiveness, which is thought to be partly mediated by their ability to induce regulatory T cells (Tregs) during human infections. This study investigates the functional capacity of Tregs from different groups of filarial patients to suppress filaria-specific immune responses during human filariasis. Microfilaremic (MF), chronic pathology (CP) and uninfected endemic normal (EN) individuals were selected in an area endemic for Brugia timori in Flores island, Indonesia. PBMC were isolated, CD4CD25hi cells were magnetically depleted and in vitro cytokine production and proliferation in response to B. malayi adult worm antigen (BmA) were determined in total and Treg-depleted PBMC. In MF subjects BmA-specific T and B lymphocyte proliferation as well as IFN-gamma, IL-13 and IL-17 responses were lower compared to EN and CP groups. Depletion of Tregs restored T cell as well as B cell proliferation in MF-positives, while proliferative responses in the other groups were not enhanced. BmA-induced IL-13 production was increased after Treg removal in MF-positives only. Thus, filaria-associated Tregs were demonstrated to be functional in suppressing proliferation and possibly Th2 cytokine responses to BmA. These suppressive effects were only observed in the MF group and not in EN or CP. These findings may be important when considering strategies for filarial treatment and the targeted prevention of filaria-induced lymphedema.
Risk Factors Associated with the Development of Atopic Sensitization in Indonesia
Firdaus Hamid, Aprilianto E. Wiria, Linda J. Wammes, Maria M. M. Kaisar, Yenny Djuardi, Serge A. Versteeg, Sitti Wahyuni, Ronald van Ree, Erliyani Sartono, Taniawati Supali, Maria Yazdanbakhsh
PLOS ONE , 2013, DOI: 10.1371/journal.pone.0067064
Abstract: Background The prevalence of allergic diseases has increased not only in high income but also in low-to-middle income countries. However, risk factors for their development are still not well established, particularly in the latter. Objective To assess prevalence and identify risk factors for sensitization to two major inhalant allergens among children from semi-urban and rural areas in Indonesia. Method A cross-sectional survey was performed among 1,674 school children aged 5–15 years old. Information on potential risk factors and reported allergic symptoms were obtained by questionnaire. Helminth infections were assessed. Skin prick tests (SPT) were performed, total IgE as well as allergen-specific IgE for house dust mite (HDM) and cockroach were measured. Result The prevalence of allergic skin sensitization to both aeroallergens was significantly higher in the semi-urban than in the rural area. However, serum IgE against HDM and cockroach as well as total IgE were significantly lower in semi-urban than in rural children. In the semi-urban area, there was a significant positive association between SPT to HDM and higher paternal education but a negative one with hookworm infection. The risk factors linked to cockroach sensitization were different: being of a farmer offspring and lacking access to piped water were associated with an increased risk for a positive SPT to cockroach. No significant associations between measured risk factors and having a positive SPT were found in the rural area. Conclusion Sensitization to HDM and cockroach is common in Indonesia, more often translating into a positive SPT in the semi-urban than in the rural setting. Whereas high paternal education and low hookworm infection were associated with increased risk of SPT to HDM, we were surprised to find parameters of lower SES were identified as risk factor for cockroach SPT.
Does treatment of intestinal helminth infections influence malaria? Background and methodology of a longitudinal study of clinical, parasitological and immunological parameters in Nangapanda, Flores, Indonesia (ImmunoSPIN Study)
Aprilianto E Wiria, Margaretta A Prasetyani, Firdaus Hamid, Linda J Wammes, Bertrand Lell, Iwan Ariawan, Hae Uh, Heri Wibowo, Yenny Djuardi, Sitti Wahyuni, Inge Sutanto, Linda May, Adrian JF Luty, Jaco J Verweij, Erliyani Sartono, Maria Yazdanbakhsh, Taniawati Supali
BMC Infectious Diseases , 2010, DOI: 10.1186/1471-2334-10-77
Abstract: To determine the effect of geohelminth infections and their treatment on malaria infection and disease outcome, as well as on immunological parameters, the area of Nangapanda on Flores Island, Indonesia, where malaria and helminth parasites are co-endemic was selected for a longitudinal study. Here a Double-blind randomized trial will be performed, incorporating repeated treatment with albendazole (400 mg) or placebo at three monthly intervals. Household characteristic data, anthropometry, the presence of intestinal helminth and Plasmodium spp infections, and the incidence of malaria episodes are recorded. In vitro cultures of whole blood, stimulated with a number of antigens, mitogens and toll like receptor ligands provide relevant immunological parameters at baseline and following 1 and 2 years of treatment rounds. The primary outcome of the study is the prevalence of Plasmodium falciparum and P. vivax infection. The secondary outcome will be incidence and severity of malaria episodes detected via both passive and active follow-up. The tertiary outcome is the inflammatory cytokine profile in response to parasite antigens. The project also facilitates the transfer of state of the art methodologies and technologies, molecular diagnosis of parasitic diseases, immunology and epidemiology from Europe to Indonesia.The study will provide data on the effect of helminth infections on malaria. It will also give information on anthelminthic treatment efficacy and effectiveness and could help develop evidence-based policymaking.This study was approved by The Ethical Committee of Faculty of Medicine, University of Indonesia, ref:194/PT02.FK/Etik/2006 and has been filed by ethics committee of the Leiden University Medical Center. Clinical trial number:ISRCTN83830814. The study is reported in accordance with the CONSORT guidelines for cluster-randomized studies.Worldwide, more than a billion people are infected by geohelminths, with a majority harboring roundworms (Ascaris lumbr
A longitudinal study of allergy and intestinal helminth infections in semi urban and rural areas of Flores, Indonesia (ImmunoSPIN Study)
Firdaus Hamid, Aprilianto E Wiria, Linda J Wammes, Maria MM Kaisar, Bertrand Lell, Iwan Ariawan, Hae Uh, Heri Wibowo, Yenny Djuardi, Sitti Wahyuni, Robert Schot, Jaco J Verweij, Ronald van Ree, Linda May, Erliyani Sartono, Maria Yazdanbakhsh, Taniawati Supali
BMC Infectious Diseases , 2011, DOI: 10.1186/1471-2334-11-83
Abstract: This study was designed to assess how intestinal helminth infections can influence the immune response and atopic and allergic disorders in children in Indonesia. The relations between allergic outcomes and infection and lifestyle factors will be addressed. This study was set up among school-age children in semi urban and rural areas, located in Ende District of Flores Island, Indonesia. A randomized placebo-controlled anthelmintic treatment trial to elucidate the impact of helminth infections on the prevalence of skin prick test (SPT) reactivity and symptoms of allergic diseases will be performed. The children living in these semi-urban and rural areas will be assessed for SPT to allergens before and after 1 and 2 years of treatment as the primary outcome of the study; the secondary outcome is symptoms (asthma and atopic dermatitis); while the tertiary outcome is immune responses (both antibody levels to allergens and cellular immune responses).The study will provide information on the influence of helminth infections and anthelmintic treatment on immune response, atopy and allergic disorders.Current Controlled Trials ISRCTN: ISRCTN83830814Helminth infections are highly prevalent worldwide, with more than two billion people chronically infected by soil transmitted helminths such as Ascaris lumbricoides, Trichuris trichiura and/or hookworms (Necator americanus or Ancylostoma duodenale) [1]. These enteric infections affect populations living in subtropical and tropical regions of low-middle income countries, where access to hygiene, sanitation and source of clear water is limited [2]. The immune responses mounted to helminth infections is characterized by T-helper type 2 (Th2), which are thought to be protective [3]. However, there is also evidence that these parasites might enhance their own survival by modulating the immune responses of their host by inducing regulatory responses that dampen activity of effector cells [4]. Whether all different helminths are equall
Relationship between Carotid Intima Media Thickness and Helminth Infections on Flores Island, Indonesia
Aprilianto Eddy Wiria, Linda J. Wammes, Firdaus Hamid, Olaf M. Dekkers, Margaretta A. Prasetyani, Linda May, Maria M. M. Kaisar, Jaco J. Verweij, Jouke T. Tamsma, Felix Partono, Erliyani Sartono, Taniawati Supali, Maria Yazdanbakhsh, Johannes W. A. Smit
PLOS ONE , 2013, DOI: 10.1371/journal.pone.0054855
Abstract: Objective To examine the association between helminth infections and atherosclerosis. Background Chronic helminth infection, which can lead to poor nutritional status and anti-inflammatory response, might protect against the development of atherosclerosis. Methods A cross-sectional study was performed in Flores, Indonesia, an area highly endemic for soil-transmitted helminths (STH). Stool samples from 675 participants aged 18–80 years were collected and screened for Trichuris trichiura by microscopy and for Ascaris lumbricoides, Necator americanus, Ancylostoma duodenale, and Strongyloides stercoralis by qPCR. We collected data on body mass index (BMI), waist to hip ratio (WHR), blood pressure, fasting blood glucose (FBG), lipid, high sensitive C-reactive protein (hs-CRP), total immunoglobulin-E (TIgE) and Escherichia coli lipopolysaccharide stimulated cytokines (tumor necrosis factor and interleukin-10). In a subset of 301 elderly adults (≥40 years of age) carotid intima media thickness (cIMT) was measured. Results Participants with any STH infection had lower BMI (kg/m2) (mean difference ?0.66, 95%CI [?1.26, ?0.06]), WHR (?0.01, [?0.02, ?0.00]), total cholesterol (mmol/L) (?0.22, [?0.43, ?0.01]) and LDL-cholesterol (mmol/L) (?0.20, [?0.39, ?0.00]) than uninfected participants. After additional adjustment for BMI the association between helminth infection and total cholesterol (mean difference ?0.17, 95%CI [?0.37, 0.03]) as well as LDL-cholesterol (?0.15, [?0.33, 0.04]) was less pronounced. BMI, WHR, and total cholesterol were negatively associated with number species of helminth co-infections. Participants with high TIgE, an indicator of exposure to helminths, had lower FBG, TC, and HDL. The association between TIgE and TC and HDL remained significant after adjustment with BMI. No clear association was found between STH infection or TIgE and mean cIMT. Conclusions This cross-sectional study presents evidence that helminth infections were negatively associated with risk factors for cardiovascular disease, an association at least partially mediated by an effect on BMI. The significance of this finding needs to be determined.
Page 1 /13
Display every page Item


Home
Copyright © 2008-2017 Open Access Library. All rights reserved.