oalib

Publish in OALib Journal

ISSN: 2333-9721

APC: Only $99

Submit

Any time

4 ( 1 )

2019 ( 240 )

2018 ( 327 )

2017 ( 268 )

Custom range...

Search Results: 1 - 10 of 134230 matches for " Rodrigues Jo?o Domingos "
All listed articles are free for downloading (OA Articles)
Page 1 /134230
Display every page Item
EFEITOS DE GIBERELINAS, CITOCININAS E DO NITRATO DE POTáSSIO, NO PROCESSO GERMINATIVO DE SEMENTES DE LIMOEIRO `CRAVO' (Citrus limonia OSBECK)
Leonel, Sarita;Rodrigues, Joo Domingos;
Scientia Agricola , 1999, DOI: 10.1590/S0103-90161999000100017
Abstract: the effects of plant growth regulators and potassium nitrate were evaluated on `rangpur' (citrus limonia) lime seed germination. seeds were extracted from ripe fruits, washed air, dried and stored at 4oc for 11 days. seeds were then treated for 24 hours as follows: with 0.1 and 0.2% of kno3; 50, 100 and 250 mg.l-1 of ga3; 100 mg.l-1 of phenylmethylaminepurine; 20 mg.l-1 of phenylmethylaminepurine and control. the evaluations were conducted at five day intervals, starting 15 days after sowing. the statistical analysis showed that the growth regulators did not enhance seed germination and that treatments with potassium nitrate at 0.1% and 0.2% inhibited germination.
EFEITOS DE GIBERELINAS, CITOCININAS E DO NITRATO DE POTáSSIO, NO PROCESSO GERMINATIVO DE SEMENTES DE LIMOEIRO `CRAVO' (Citrus limonia OSBECK)
Leonel Sarita,Rodrigues Joo Domingos
Scientia Agricola , 1999,
Abstract: Foram estudados os efeitos de reguladores vegetais do grupo das giberelinas e citocininas, bem como do nitrato de potássio na germina o de sementes do limoeiro `Cravo' (Citrus limonia Osbeck). O experimento foi realizado, contendo papel de filtro como substrato para a germina o das sementes, regulado à temperatura de 25oC. As sementes foram retiradas de frutos maduros no final da safra do limoeiro `Cravo', lavadas, secas à sombra e armazenadas durante 11 dias em camara fria. Em seguida, receberam tratamento com os fitorreguladores e KNO3 por 24 horas, de acordo com os tratamentos: KNO3 0,1% e 0,2%; GA3 50, 100 e 250 mg.L-1; GA4 + GA7 + fenilmetilaminopurina 100 mg.L-1; fenilmetilaminopurina 20 mg.L-1 e água destilada (testemunha). As avalia es foram iniciadas 15 dias após a semeadura, em intervalos de 5 dias. Conclui-se que os reguladores vegetais utilizados n o afetaram o processo germinativo das sementes e que os tratamentos com nitrato de potássio 0,1% e 0,2% exerceram efeito inibitório sobre a germina o.
Redu??o de sementes do tangor 'Murcote' com a aplica??o de biorreguladores durante o florescimento
Domingues, Marcio Christian Serpa;Rodrigues, Joo Domingos;
Ciência e Agrotecnologia , 2007, DOI: 10.1590/S1413-70542007000300023
Abstract: the present experiment was conducted in a commercial tangor 'murcote' citrus grove in pratania, s?o paulo state, brazil and had the objective to evaluate the effects of, 2,4-d (auxin), naa (auxin), ga3 (gibberellin) and ba (cytokinin), on the reduction of seed number, without modifications on citrus fruit quality. the treatments sprayed were as follow: control (water); 10 and 20 mg.l-1 of 2,4-d; 100, 150 and 200 mg.l-1 of naa; 100 and 200 mg.l-1 of ga3 ; 20 and 40 mg.l-1 of ba. the results showed that none of plant growth regulators influenced fruit quality, without weight reduction, diameter or obrix. in relation to seed number, none of the plant growth regulators were effective on reduction of seed number, however the reduced of viable seed number and total seed number of fruits, specially with the treatment of 100 and 200 mg.l-1 of naa and 100 mg.l-1 of ga3, that showed a reduction of 30% of total seed of tangor murcott fruits.
Gibberellin and cytokinin effects on soybean growth
Leite, Vagner Maximino;Rosolem, Ciro Antonio;Rodrigues, Joo Domingos;
Scientia Agricola , 2003, DOI: 10.1590/S0103-90162003000300019
Abstract: soybean is an important crop in brazil. nonetheless, there are no reports on the use of plant growth regulator potential in relation to this crop in the national literature. to better understand the role of these compounds, a pot experiment was carried out to study effects of ga3 and cytokinin on the vegetative growth of the soybean. ga3 (50 mg l-1) was applied as seed treatment, leaving plants with water application as control. ga3 (100 mg l-1) and cytokinin (30 mg l-1) were sprayed on leaves at the physiological stage v3/v4, and 15 days after, cytokinin (30 mg l-1), also as foliar spray. seed treatment decreased plant emergence and initial soybean root growth, but as the season progressed, differences in root growth disappeared; plants were shorter, and presented a decrease in the number of nodes, in stem diameter, in leaf area and in dry matter yield. conversely, foliar application of ga3 led to an increase in plant height, first node height and stem diameter. leaf area and dry matter production also increased as a result of ga3 foliar application. there was no effect of exogenous gibberellin and cytokinin on the number of soybean leaves, number of stem branches and root dry matter. joint application of gibberellin and cytokinin tended to inhibit gibberellin effects. cytokinin applied to leaves during soybean vegetative growth was not effective in modifying any of the evaluated plant growth variables.
Gibberellin and cytokinin effects on soybean growth
Leite Vagner Maximino,Rosolem Ciro Antonio,Rodrigues Joo Domingos
Scientia Agricola , 2003,
Abstract: Soybean is an important crop in Brazil. Nonetheless, there are no reports on the use of plant growth regulator potential in relation to this crop in the national literature. To better understand the role of these compounds, a pot experiment was carried out to study effects of GA3 and cytokinin on the vegetative growth of the soybean. GA3 (50 mg L-1) was applied as seed treatment, leaving plants with water application as control. GA3 (100 mg L-1) and cytokinin (30 mg L-1) were sprayed on leaves at the physiological stage V3/V4, and 15 days after, cytokinin (30 mg L-1), also as foliar spray. Seed treatment decreased plant emergence and initial soybean root growth, but as the season progressed, differences in root growth disappeared; plants were shorter, and presented a decrease in the number of nodes, in stem diameter, in leaf area and in dry matter yield. Conversely, foliar application of GA3 led to an increase in plant height, first node height and stem diameter. Leaf area and dry matter production also increased as a result of GA3 foliar application. There was no effect of exogenous gibberellin and cytokinin on the number of soybean leaves, number of stem branches and root dry matter. Joint application of gibberellin and cytokinin tended to inhibit gibberellin effects. Cytokinin applied to leaves during soybean vegetative growth was not effective in modifying any of the evaluated plant growth variables.
Privacy-Preserving Content-Based Image Retrieval in the Cloud
Bernardo Ferreira,Joo Rodrigues,Joo Leit?o,Henrique Domingos
Computer Science , 2014,
Abstract: Storage requirements for visual data have been increasing in recent years, following the emergence of many new highly interactive, multimedia services and applications for both personal and corporate use. This has been a key driving factor for the adoption of cloud-based data outsourcing solutions. However, outsourcing data storage to the Cloud also leads to new challenges that must be carefully addressed, especially regarding privacy. In this paper we propose a secure framework for outsourced privacy-preserving storage and retrieval in large image repositories. Our proposal is based on a novel cryptographic scheme, named IES-CBIR, specifically designed for media image data. Our solution enables both encrypted storage and querying using Content Based Image Retrieval (CBIR) while preserving privacy. We have built a prototype of the proposed framework, formally analyzed and proven its security properties, and experimentally evaluated its performance and precision. Our results show that IES-CBIR is provably secure, allows more efficient operations than existing proposals, both in terms of time and space complexity, and enables more realistic, interesting and practical application scenarios.
Application of brassinosteroid to Tabebuia alba (Bignoniaceae) plants
ONO, ELIZABETH ORIKA;NAKAMURA, TERUKO;MACHADO, SíLVIA RODRIGUES;RODRIGUES, JOO DOMINGOS;
Revista Brasileira de Fisiologia Vegetal , 2000, DOI: 10.1590/S0103-31312000000300002
Abstract: the objective of this study was to observe the effects of brassinosteroid, gibberelin, and auxin application on the development and foliar anatomy of tabebuia alba (cham.) sandw. seedlings. t. alba seedlings were grown in plastic bags with fertilized soil and treated with the following: 1- water (control); 2- brassinolide (br1) 0.104 mm; 3- br1 0.208 mm; 4- 3-indoleacetic acid (iaa) 0.2854 mm; 5- iaa 0.5708 mm; 6- ga3 (gibberellin a3) 0.1443 mm; 7- ga3 0.2887 mm; 8- ga3 0.072 mm + iaa 0.1427 mm; 9- ga3 0.1443 mm + iaa 0.2854 mm; 10- ga3 0.072 mm + br1 0.052 mm; and 11- ga3 0.1443 mm + br1 0.104 mm. plant height and petiole length were measured before the treatments and 21 days after application of the growth regulators. these data allowed the calculation of stem and petiole growth rates. the results showed that ga3 + brassinolide produced the highest stem and petiole growth rates and brassinolide application stimulated petiole growth but not stem growth. the anatomical study of leaves showed alterations in blade and petiole thickness, palisade and spongy parenchyma height, and epidermis cells.
EFEITOS DA APLICA O DE REGULADORES VEGETAIS NA CULTURA DA ALFACE (Lactuca sativa) CRESPA var. Ver nica e AMERICANA var. Lucy Brow.
REPKE, Rodrigo Alberto,VELOZO, Murilo Rodrigues,DOMINGUES, Marcio Christian.Serpa,RODRIGUES, Joo Domingos
Nucleus , 2009,
Abstract: The lettuce is a vegetable leafy of larger commercial value cultivated in Brazil, for about 75commercial varieties. Plant of tranquilizing properties is considered, with high vitamin tenor A, B and C, besidescalcium, match, potassium and others mine. The Present work had as objective evaluates the agronomic efficiency ofthe plant growth regultors on the physiologic and productive aspects of the culture of the lettuce curly variety“Veronica” and lettuce American variety “Lucy Brow”. The rehearsal was developed in commercial property ofvegetables leafy, located in the municipal district of Fern o, state of S o Paulo, in a completely randomized, with fourreplication and sixteen plants for plot, totaling six treatments, T1 - control, T2 - 75ml.100L-1, T3 - 100ml.100L-1, T4 -125ml.100L-1, T5 - 150ml.100L-1, T6 - 175ml.100L-1 of plant growth regulator stimulate. The evaluation parameterswere accomplished during the crop about the following determinations: Chlorophyll rates, diameter of the heads oflettuce, medium weight of the feet, number of leaves and incidence of it burns of boards. In a “Veronica”, significantincrease was observed in a vegetative development and medium weight of the plants specifically in dosage of150ml.100L-1, regarding elevation of the chlorophyll rates the American variety “Lucy Brow” presented larger rates ina concentration of 100ml.L-1 of Stimulate.A alface é uma hortali a folhosa de maior valor comercial cultivada no Brasil, com cerca de 75variedades comerciais. é considerada planta de propriedades tranqüilizantes, com elevado teor de vitamina A, B e C,além de cálcio, fósforo, potássio e outros minerais. O Presente trabalho teve como objetivo avaliar os efeitos dobioregulador stimulate sobre os aspectos fisiológicos e produtivos da cultura da alface crespa variedade “Ver nica” ealface americana variedade “Lucy Brow”. O ensaio foi desenvolvido em propriedade comercial de hortali as folhosas,situada no município de Fern o, estado de S o Paulo, com 6 tratamentos em delineamento de blocos ao acaso, comquatro repeti es e dezesseis plantas por parcela, totalizando seis tratamentos, T1- testemunha, T2- 75ml.100L-1, T3-100ml.100L-1, T4- 125ml.100L-1, T5- 150ml.100L-1, T6- 175ml.100L-1 de stimulate. Os parametros avaliados foram:Teor de clorofila, diametro dos plantas de alface, peso médio das plantas, numero médio de folhas por planta eincidência de queima de bordos nas folhas. Para a variedade crespa “Ver nica” observou-se aumento significativo nodesenvolvimento vegetativo com maior peso médio das plantas especificamente em dosagem de 150
Application of brassinosteroid to Tabebuia alba (Bignoniaceae) plants
ONO ELIZABETH ORIKA,NAKAMURA TERUKO,MACHADO SíLVIA RODRIGUES,RODRIGUES JOO DOMINGOS
Revista Brasileira de Fisiologia Vegetal , 2000,
Abstract: The objective of this study was to observe the effects of brassinosteroid, gibberelin, and auxin application on the development and foliar anatomy of Tabebuia alba (Cham.) Sandw. seedlings. T. alba seedlings were grown in plastic bags with fertilized soil and treated with the following: 1- water (control); 2- brassinolide (BR1) 0.104 mM; 3- BR1 0.208 mM; 4- 3-indoleacetic acid (IAA) 0.2854 mM; 5- IAA 0.5708 mM; 6- GA3 (gibberellin A3) 0.1443 mM; 7- GA3 0.2887 mM; 8- GA3 0.072 mM + IAA 0.1427 mM; 9- GA3 0.1443 mM + IAA 0.2854 mM; 10- GA3 0.072 mM + BR1 0.052 mM; and 11- GA3 0.1443 mM + BR1 0.104 mM. Plant height and petiole length were measured before the treatments and 21 days after application of the growth regulators. These data allowed the calculation of stem and petiole growth rates. The results showed that GA3 + brassinolide produced the highest stem and petiole growth rates and brassinolide application stimulated petiole growth but not stem growth. The anatomical study of leaves showed alterations in blade and petiole thickness, palisade and spongy parenchyma height, and epidermis cells.
Padroniza o da metodologia do RT-PCR utilizado para identifica o do mRNA da alfa-amilase em sementes de milho RT-PCR patterning for alpha-amylase messenger RNA identification in germinating maize seeds
Bárbara Fran?a Dantas,Carlos Alberto Arag?o,Joo Pessoa Araújo-Junior,Joo Domingos Rodrigues
Revista Brasileira de Sementes , 2002,
Abstract: Durante a germina o das sementes, os carboidratos de reserva s o degradados pela atividade de a-amilase. A identifica o de mRNA é uma ferramenta fundamental para a defini o da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germina o das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modifica es. A partir do RNA total extraído foi obtido cDNA com utiliza o de "random primers". A amplifica o por PCR de uma por o do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por rea o e completados com água tratada com DEPC. Os ciclos para a amplifica o foram 94oC durante 4 minutos, seguidos por 34 ciclos de 94oC durante 1 minuto, 42oC durante 1 minuto e 72oC durante 1,5 minutos e, finalmente, 72oC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, n o ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identifica o da express o de alfa-amilase durante a germina o das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germina o. During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction method, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94oC/4 minutes, 34 cycles of 94oC /1 minute, 42oC/1 minute and 72oC/1,5 minutes, and finally 72oC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands.
Page 1 /134230
Display every page Item


Home
Copyright © 2008-2017 Open Access Library. All rights reserved.