oalib

Publish in OALib Journal

ISSN: 2333-9721

APC: Only $99

Submit

Any time

4 ( 1 )

2020 ( 1 )

2019 ( 43 )

2018 ( 64 )

Custom range...

Search Results: 1 - 10 of 27282 matches for " Ivana; Domingos Araújo "
All listed articles are free for downloading (OA Articles)
Page 1 /27282
Display every page Item
Nueva territorialidad: Caso S?o Bartolomeu (Mina Gerais) - Brasil
Benevides Dutra Murta,Ivana; Domingos Araújo,Ligia Cristina; Goncalves Campos,Julio; Machado Gontijo,Bernardo;
Estudios y perspectivas en turismo , 2009,
Abstract: the aim of this case study was to discuss if the recent process of turistification has influenced the daily life of the residents of s?o bartolomeu, district of ouro preto (mina gerais), brazil, and if the growth of tourism has given a new shape to the spatial, territorial and symbolic environment. therefore, a qualitative study was undertaken by means of data collection using participative observation and interviews interpreted as a tool of the discourse analysis. the main items here presented are the tourist [des] territorialization and the environmental perception. this study has shown that the process of turistification in the district has changed aspects of every day life that can be seen from the perceptions locals have of their environment.
Nueva territorialidad: Caso S o Bartolomeu (Mina Gerais) - Brasil New Territorialities and Tourism: the case of S o Bartolomeu (Mina Gerais), Brazil
Ivana Benevides Dutra Murta,Ligia Cristina Domingos Araújo,Julio Goncalves Campos,Bernardo Machado Gontijo
Estudios y perspectivas en turismo , 2009,
Abstract: Este estudio de caso fue realizado en S o Bartolomeu, distrito de Ouro Preto (Minas Gerais) y el objetivo principal fue discutir la manera en que el reciente proceso de turistificación ha influido en la vida cotidiana de sus habitantes. Asimismo, se quiso determinar la forma en que el crecimiento del turismo en S o Bartolomeu provocó la reconfiguración espacial, territorial y simbólica del medioambiente local. Por lo tanto, se realizó una investigación cualitativa recolectando datos a través de la observación participante y la entrevista que fue interpretada con herramientas de análisis del discurso. Los principales temas que aquí se presentan son la [des]territorialización turística y la percepción ambiental. A partir de este estudio se entendió que el proceso de turistificación en el distrito abarcado reconfigura aspectos de lo cotidiano reflejados en las percepciones ambientales de los sujetos. The aim of this case study was to discuss if the recent process of turistification has influenced the daily life of the residents of S o Bartolomeu, district of Ouro Preto (Mina Gerais), Brazil, and if the growth of tourism has given a new shape to the spatial, territorial and symbolic environment. Therefore, a qualitative study was undertaken by means of data collection using participative observation and interviews interpreted as a tool of the discourse analysis. The main items here presented are the tourist [des] territorialization and the environmental perception. This study has shown that the process of turistification in the district has changed aspects of every day life that can be seen from the perceptions locals have of their environment.
Avalia o do Potencial de Produtos Derivados de Aeronaves N o Tripuladas na Atividade Florestal / Assessment of Potential From Products of Unmanned Airbone Vehicle Use in Forestry Activities
Marcelo Antunes Araújo,Fernando Chavier,Jocival Luiz Domingos
Ambiência , 2006,
Abstract: A Aracruz Celulose S.A., líder mundial na produ o de celulose branqueada de eucalipto de mercado, tem procurado fazer um uso intensivo de produtos de sensoriamento remoto como suporte à realiza o das atividades florestais. Recentemente avaliado, o uso de Veículos Aéreos N o Tripulados (UAV) mostrou-se bastante promissor e por isso foi definido o aprofundamento dos estudos a fim de determinar se os resultados efetivos de um estudo prático em plantios jovens na obten o de dados de sobrevivência e qualidade do plantio podem ser obtidos em escala comercial. O produto final do estudo disponibilizou dados de número de mudas / árvores, mortalidade, espa amento entre linhas e entre plantas, desvio da linha de plantio e área da copa com precis o adequada para poder substituir os métodos convencionais de coleta destes dados. Este trabalho mostrou que o UAV pode ser usado na coleta de dados por imagens e deste material podem ser extraídas informa es importantes para a avalia o da qualidade dos plantios recém realizados.
Ambiente familiar e aprendizagem escolar em alunos da educa o infantil
Ferreira, Susie Helena Araújo,Barrera, Sylvia Domingos
Psico , 2010,
Abstract: O objetivo desta pesquisa foi analisar as rela es entre ambiente familiar e desempenho escolar na Educa o Infantil. Participaram 30 crian as, com idade entre cinco e seis anos, alunas do Pré-III de uma escola pública, e um informante familiar das mesmas. Os pais responderam um questionário sobre condi es socioecon micas, educacionais, constitui o familiar, e também o RAF – Inventário de Recursos do Ambiente Familiar. O desempenho escolar foi avaliado pelas habilidades de escrita dos alunos. Os resultados indicaram associa o entre desempenho e recursos do ambiente familiar (RAF), especialmente brinquedos, jornais, revistas e livros e entre escolaridade materna e RAF. Constitui o familiar e nível socioecon mico (NSE) n o se associaram ao desempenho, mas foi obtida correla o entre NSE e RAF. Conclui-se que os principais fatores associados ao desempenho escolar s o a presen a de objetos culturais, que podem ser propiciado pela escola, discutindo-se a necessidade desta rever certos mitos relativos às “causas familiares” do fracasso escolar.
Evaluation of intervarietal maize hybrids through partial diallel cross, considering four environments/ Avalia o de híbridos intervarietais de milho por meio de cruzamento dialélico parcial, considerando quatro ambientes
Deoclécio Domingos Garbuglio,Pedro Mário de Araújo
Semina : Ciências Agrárias , 2006,
Abstract: In the summer season of 2004/2005, 12 intervarietal maize hybrids, crossed by the partial diallel scheme 3 x 4, the seven parental populations and three checks were evaluated at Iapar Experimental Stations in Londrina, Pato Branco, Ponta Grossa e Guarapuava. The objective was to identify crosses for future work with recurrent selection, inbred lines extraction and composite synthesis. For Heterosis variation cause, the differences were determined (P<0.01) for traits grain yield and female flowering, indicating thatcrosses were superior in relation to parentals. Regarding General Combining Ability values for yield, the parentals from Group-1, PC 9407 and BR 106, showed values of 36.7 kg.ha-1 and 171.1 kg.ha-1, respectively,and the parentals from Group-2 presented values of 131.1 kg.ha-1 and 56.8 kg.ha-1, respectively,. For Specific Combining Ability, the largest values were from PC 9701 x BR 106 (205.4 kg.ha-1) e PC 9502 x PC 9407 (135.3 kg.ha-1) and, the largest values of grain yield average (9297 e 9018 kg.ha-1, respectively). The populations PC 9701, BR 106, PC 9502 and PC 9407 are promising sources for inbred lines extraction aiming to superior maize hybrids development, composite synthesis and recurrent selection. Foram avaliados 12 híbridos intervarietais de milho (Zea mays L.), cruzados em esquema dialélico parcial 3 x 4 mais as sete popula es parentais e 3 testemunhas. Os ensaios foram implantados nas esta es experimentais do Iapar em Londrina, Pato Branco, Ponta Grossa e Guarapuava. O objetivo foi avaliar um conjunto de sete popula es no sentido de se estimar parametros que venham a auxiliar na escolha de materiais para posteriores trabalhos com sele o recorrente, extra o de linhagens e síntese de compostos. Para a fonte Heterose as diferen as foram constatadas (p < 0,01) para as variáveis produtividade de gr os e florescimento feminino, indicando que os cruzamentos foram superiores aos pais. Em rela o aos valores de Capacidade Geral de Combina o para rendimento, os parentais do grupo-1, PC 9407 e BR 106, obtiveram como valores 36,7 e 171,1 kg.ha-1, respectivamente, e os parentais do grupos-2, PC 9701 e PC 9502, apresentaram valores de 131,1 e 56,8 kg.ha-1, respectivamente,. Para a Capacidade Específica de Combina o, os maiores valores foram para PC 9701 x BR 106 (205,4 kg.ha-1) e PC 9502 x PC 9407 (135,3 kg.ha-1), assim como as maiores médias de produtividade de gr os dos cruzamentos avaliados (9.297 e 9.018 kg.ha-1, respectivamente). As popula es PC 9701, BR 106, PC 9502 e PC 9407 s o promissoras fontes para a extra o de linhagens vi
Padroniza o da metodologia do RT-PCR utilizado para identifica o do mRNA da alfa-amilase em sementes de milho RT-PCR patterning for alpha-amylase messenger RNA identification in germinating maize seeds
Bárbara Fran?a Dantas,Carlos Alberto Arag?o,Jo?o Pessoa Araújo-Junior,Jo?o Domingos Rodrigues
Revista Brasileira de Sementes , 2002,
Abstract: Durante a germina o das sementes, os carboidratos de reserva s o degradados pela atividade de a-amilase. A identifica o de mRNA é uma ferramenta fundamental para a defini o da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germina o das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modifica es. A partir do RNA total extraído foi obtido cDNA com utiliza o de "random primers". A amplifica o por PCR de uma por o do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por rea o e completados com água tratada com DEPC. Os ciclos para a amplifica o foram 94oC durante 4 minutos, seguidos por 34 ciclos de 94oC durante 1 minuto, 42oC durante 1 minuto e 72oC durante 1,5 minutos e, finalmente, 72oC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, n o ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identifica o da express o de alfa-amilase durante a germina o das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germina o. During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction method, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94oC/4 minutes, 34 cycles of 94oC /1 minute, 42oC/1 minute and 72oC/1,5 minutes, and finally 72oC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands.
Microbiologia dos abscessos peritonsilares
Sakae, Flavio Akira;Imamura, Rui;Sennes, Luiz Ubirajara;Araújo Filho, Bernardo Cunha;Tsuji, Domingos Hiroshi;
Revista Brasileira de Otorrinolaringologia , 2006, DOI: 10.1590/S0034-72992006000200016
Abstract: aim: the objective of the present study was to analyze the microbiology of peritonsillar abscesses. methods: thirty patients, mean age 24,2 years, with peritonsillar abscesses underwent aspiration of at least 3 ml of pus, which was cultured for aerobes and anaerobes. results: 87% samples showed positive cultures. aerobic or facultative aerobic bacteria were isolated from 23% aspirates, mixed aerobic and anaerobic bacteria from 60%, and anaerobic bacteria from only 3% aspirate. a total of 69 bacterial isolates (34 aerobic and 35 anaerobic) were recovered. the most common aerobic isolate was streptococcus sp, with streptococcus pyogenes being identified in 23% of aspirates. the predominant anaerobic isolates were prevotella sp and peptostreptococcus sp. patients had received previous antimicrobial therapy in 63% cases. in this group, 1.8 isolates per specimen were recovered, a lower number than in the untreated group (3.0 per specimen). no significant difference in the species isolated was observed between these two groups. conclusion: peritonsillar abscess is usually a polymicrobial infection, with predominance of anaerobic bacteria. the number of agents isolated was larger in patients not previously treated with antibiotics, but the use of antimicrobial drugs did not interfere with the type of bacterium isolated.
Efeito do uso de povidine-iodine na cicatriza??o de anastomoses de cólon direito de ratos
Milagres, Leandro Cruz;Araújo, Ivana Duval;Barral, Sumara Marques;Grossi, Giovanni César Xavier;
Arquivos de Gastroenterologia , 2005, DOI: 10.1590/S0004-28032005000200006
Abstract: background: anastomotic leakage is a major cause of mortality in colorectal surgery. several methods have been evaluated in order to prevent anastomotic leakage, and was postulate that povidone-iodine irrigation of colon before anastomosis can improve anastomotic healing, prevent adhesion formation, and may be beneficial in patients undergoing gastrointestinal surgery. aim: to evaluates the efficacy of this agent in healing of colonic anastomosis in rats. material and methods: twenty wistar rats were divided into two groups: group a (n = 10), cleaning of anastomotic borders with saline solution, and group b (n = 10), cleaning of anastomotic borders with 5% povidone-iodine. the animals were submitted to laparotomy, section of colon and treatment according previously described. after anastomosis, the animals were observed, and killed in 7th postoperative day. blood samples were collected to serum albumin measurement and anastomosis observed macroscopically in relation to presence of fistula, adhesion and dilatation. a 6 cm colonic segment with the anastomosis at the center was excised bursting pressure was determined. result: there was no fistula in any animal in both groups, and there was no difference in relation to obstruction, presence of adhesion or bursting pressure when compared group a and b. conclusion: the use of povidone-iodine was not able to improve anastomotic healing in rats.
Perioperative fluorocholangiography with routine indication versus selective indication in laparoscopic cholecystectomy
Guerra-Filho, Vicente;Nunes, Tarcizo Afonso;Araújo, Ivana Duval;
Arquivos de Gastroenterologia , 2007, DOI: 10.1590/S0004-28032007000300017
Abstract: background: the use of routine or selective peroperatory cholangiography in cholecystectomy is a matter of controversy in literature. aim: to compare the efficacy of selective or routine fluorocholangiography in diagnostic of common bile duct stone in patients underwent to laparoscopic cholecystectomy based on selective indication criteria. method: two hundred and fifty four patients with cholelithiasis were prospectively studied. the patients were divided in two groups: to the first 127 patients perioperative fluorocholangiography was indicated as routine (group 1), and to the other 127 patients perioperative fluorocholangiography indication followed clinical criteria (jaundice, choluria, fecal acholia and history of pancreatitis), laboratory criteria (increase in seric alkaline phosphatase, bilirubins, amylase) or ultra-sonographyc criteria (less than 6 mm diameter calculi, common bile duct stone, common bile duct diameter more than 6 mm). a comparative assessment of the difference in common bile duct stone diagnosis, fluorocholangiography success index and reliability of the selective criteria of indication for perioperative fluorocholangiography was compared between the two groups. results: perioperative fluorocholangiography was successfully performed in 102 of the 127 patients from group 1 (a rate of 80.3%), and in 59 of the 71 patients from group 2 (a rate of 83.1%). in the 102 patients of group 1 who underwent perioperative fluorocholangiography, 11 (10.8%) presented common bile duct stone, 4 (3.9%) presented common bile duct dilatation, and 1 (1%) had a false-positive image. in the 59 patients from group 2, 7 (11.7%) presented common bile duct stone and one (1.7%) presented a common bile duct diatation. in another situation, when application of selective indication criteria to perioperative fluorocholangiography was simulated in group 1 patients, we observed that only in one patient with common bile duct stone the diagnostic would not have been made. fluoro
Survival and Prognostic Factors for AIDS and Non-AIDS Patients with Non-Hodgkin’s Lymphoma in Bahia, Brazil: A Retrospective Cohort Study
Estela Luz,Marinho Marques,Ivana Luz,Cristiani Stelitano,Eduardo Netto,Iguaracyra Araújo,Carlos Brites
ISRN Hematology , 2013, DOI: 10.1155/2013/904201
Abstract: Despite the benefits of HAART, HIV-infected patients are increasingly affected by different malignancies. We compared a 5-year-period survival time and prognostic factors for HIV-1-infected individuals diagnosed with non-Hodgkin lymphomas (NHL) in a nested case-control study, with non-HIV-infected individuals in Salvador, Brazil. Survival time and prognostic factors were compared to HIV-negative patients. 31 cases (versus 63 controls) had a significantly more advanced NHL at diagnosis and lower mean CD4 count (26?cells/mm3) than controls. Mean overall survival (OS) was 35.8 versus 75.4 months, for cases and controls, respectively ( ), while mean event-free survival time (EFS) was 34.5 months for cases, versus 68.8 for controls ( ). Higher IPI, increased LDH levels, bone marrow infiltration, lower absolute lymphocyte counts (<1,000?cells/mm3), and type B symptoms were associated with a shorter survival time for cases. Although patients without poorer prognostic factors at baseline had an OS comparable to controls, the mean CD4 cell count for cases was similar for patients with favorable and nonfavorable response to therapy. Our findings suggest that HIV-1 infection is significantly associated with a shorter survival time for patients with NHL, independently of other predictive factors and of disease stage. 1. Introduction The main characteristic of AIDS is a severe immunodeficiency caused by the progressive depletion of CD4+ T-cells and consequent immune impairment [1]. These facts ultimately lead to an increasing risk of developing opportunistic infections and malignancies [2, 3]. Non-Hodgkin lymphoma (NHL) is an AIDS-defining condition, and its frequency seems to be decreasing after the highly active antiretroviral therapy (HAART) became the standard of care for the management of AIDS patients [4, 5]. HAART has promoted a great increase in the lifespan of HIV-infected patients and decreased the morbidity and mortality caused by AIDS [6]. However, the available evidence suggests that around half of the patients treated are unable to reach a normal CD4+ cell count, even after years of persistent viral suppression. One of the reasons for such findings is the persistent immune activation, but its causative mechanisms are still a matter of debate [7]. These facts may be responsible for the persistence of a higher risk for the development of other malignancies, a trend recently detected in treated AIDS patients, as a likely consequence of incomplete immune restoration. While there is a clear trend toward reducing AIDS-defining events (which include Kaposi’s
Page 1 /27282
Display every page Item


Home
Copyright © 2008-2017 Open Access Library. All rights reserved.