oalib

Publish in OALib Journal

ISSN: 2333-9721

APC: Only $99

Submit

Any time

4 ( 1 )

2019 ( 57 )

2018 ( 342 )

2017 ( 327 )

Custom range...

Search Results: 1 - 10 of 213973 matches for " Carlos Magno B. Araújo "
All listed articles are free for downloading (OA Articles)
Page 1 /213973
Display every page Item
Testing through Fall of Potential with High Current Injection in Grounding System in Transmission Line of 500 kV of Santo Antonio HPS  [PDF]
Carlos Magno B. Araújo, Luiz H. P. C. Trondoli
Open Access Library Journal (OALib Journal) , 2017, DOI: 10.4236/oalib.1103323
Abstract:
This paper presents the application of grounding resistance measurement by fall of potential with high current injection, applied to the Transmission Line (TL) of 500 kV of Santo Antonio Hydroelectric Power Station (HPS), located in the city of Porto Velho/RO, for the commissioning of the power house grounding system in Generation Group (GG2) and TL during construction of the referred project. Based on measurements obtained in field, computer simulations were performed to assess the effectiveness of the grounding system on future fault scenarios of the TL, as well as the suitability of relevant protection functions. The computer simulations are based on the model developed for TL 500 kV of GG2, and are performed using the PSCAD/EMTDC software, including the grounding values derived from the design of high current injection, according to (IEEE Std 80-2013). In order to attest the efficacy of both GG2 grounding system and TL from the HPS, COMTRADE files, obtained by the software, were used in the simulator Doble 6150 for the design of distinct fault conditions in a SEL-421 relay. Results indicate the correct functioning of relay SEL-421, corroborating the effectiveness of both grounding system and measurement method.
Histiocitose de células de Langerhans em margem anal: relato de caso e revis?o da literatura
Magno, Jaime Coelho Carlos;D'Almeida, Dianice Gallo;Magalh?es, José Pinheiro;Pires, Vilmar José;Araújo, M?nica Leite de;Miranda, Cláudia Barreto de;Nagel, Janaina;
Revista Brasileira de Coloproctologia , 2007, DOI: 10.1590/S0101-98802007000100012
Abstract: a rare case of langerhans cell histiocytosis with perianal involvement in a 34 year old white man is presented. during nineteen months this patient had a complaint of anal pain with bleeding, due to a large perianal ulcer. the initial diagnosis was crohn's disease, anal tuberculosis, syphilis, pyoderma gangrenosum or donovanosis. after the third biopsy, the surgical specimens showed microscopic changes suggestives of langerhans cell histiocytosis. the imunohistochemical study was positive to s100 protein and cd1a. the patient was treated with six doses of intralesional triancinolona and oral thalidomide for three months. treatment was well tolerated and complete resolutions of peri-anal ulcer occurred.
Padroniza o da metodologia do RT-PCR utilizado para identifica o do mRNA da alfa-amilase em sementes de milho RT-PCR patterning for alpha-amylase messenger RNA identification in germinating maize seeds
Bárbara Fran?a Dantas,Carlos Alberto Arag?o,Jo?o Pessoa Araújo-Junior,Jo?o Domingos Rodrigues
Revista Brasileira de Sementes , 2002,
Abstract: Durante a germina o das sementes, os carboidratos de reserva s o degradados pela atividade de a-amilase. A identifica o de mRNA é uma ferramenta fundamental para a defini o da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germina o das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modifica es. A partir do RNA total extraído foi obtido cDNA com utiliza o de "random primers". A amplifica o por PCR de uma por o do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por rea o e completados com água tratada com DEPC. Os ciclos para a amplifica o foram 94oC durante 4 minutos, seguidos por 34 ciclos de 94oC durante 1 minuto, 42oC durante 1 minuto e 72oC durante 1,5 minutos e, finalmente, 72oC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, n o ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identifica o da express o de alfa-amilase durante a germina o das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germina o. During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction method, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94oC/4 minutes, 34 cycles of 94oC /1 minute, 42oC/1 minute and 72oC/1,5 minutes, and finally 72oC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands.
Densidade e tamanho populacional de mamíferos cinegéticos em duas Unidades de Conserva??o do Estado do Rio de Janeiro, Brasil
Araújo, Roberta M. de;Souza, Maíra B. de;Ruiz-Miranda, Carlos R.;
Iheringia. Série Zoologia , 2008, DOI: 10.1590/S0073-47212008000300014
Abstract: the atlantic rain forest even though suffering intense devastation, shelters 261 species of mammals, 73 endemic. large mammals were among the most vulnerable to hunting, loss of habitat, and wildlife trade. in the state of rio de janeiro there are only two federal biological reserves of lowland atlantic rain forest, the po?o das antas biological reserve and the uni?o biological reserve. the purpose of this study was to assess the presence and putative influence of illegal hunting on the mammals in these two conservation units. surveys were conducted using a line-transect method; 375 kilometers were covered during the period between december 2003 and january 2005. the data for the population density estimate was analyzed using the program distance 5.0. twelve species were confirmed through visual encounters during the surveys, whereas are regularly hunted in the region studied. the species that presented higher density were brown capuchin monkey (cebus nigritus erxleben, 1777), howler monkey (alouatta guariba lacépède, 1799), nine-banded long-nosed armadillo (dasypus novemcintus linnaeus, 1758), and the seven-banded long-nosed armadillo (dasypus septemcinctus linnaeus, 1758). the most rare or absent species were the brazilian tapir (tapirus terrestris brünnich, 1771), the red brocket deer (mazama americana rafinesque, 1817) and the white-lipped peccary (tayassu pecari link, 1795). in these two study areas both direct and indirect evidence of illegal hunting was observed, indicating that hunting is a common practice inside these biological reserves. the long-term survival of the hunted species is questionable, because the remaining populations living in fragments that are small and isolated, making them more susceptible to extinction even under low hunting pressure.
Peso flutuante no tratamento de mulheres obesas
Andrade, Bárbara M. C.;Mendes, Carlos M. Cardeal;Araújo, Leila M. Batista;
Arquivos Brasileiros de Endocrinologia & Metabologia , 2004, DOI: 10.1590/S0004-27302004000200011
Abstract: long-term treatment of obese patients shows that the majority of them regains weight or has weight cycling (wc). we have studied the frequency of wc (weight lost and regain of at least 5% of initial weight, iw) in 218 obese women selected from a university hospital with a follow-up of >12 months admitted between 1992 and 2000. patients with psychiatric, infectious or chronic disease (except metabolic syndrome), pregnancy, or using glucocorticoids were excluded. mean age was 38±10 years (range 18 to 68) and the mean bmi was 41.0±6.6 kg/m2 (range 30 to 76). all were treated with a hypocaloric diet and increased physical activity. anti-obesity medications were used in 61% of them for short periods of time. in the follow-up of 28±16 months (range 12 to 92 mo, median 23 mo), wc was observed in 62/218 (28.4%) of them and 53 had weight lost followed by weight regain. in the weight-cyclers, 59.1% of patients regained weight before the first year of treatment. wc was associated with alcohol consumption higher than 60g/week, (rr 2.4; 95% ci= 1.2-4.7) but not with obesity class, smoking or smoke cessation. we conclude that wc is highly frequent and alcohol consumption is a predictive risk factor.
Agricultural crops in the diet of bearded capuchin monkeys, Cebus libidinosus Spix (Primates: Cebidae), in forest fragments in southeast Brazil
Freitas, Carlos Henrique de;Setz, Eleonore Z. F.;Araújo, Alba R. B.;Gobbi, Nivar;
Revista Brasileira de Zoologia , 2008, DOI: 10.1590/S0101-81752008000100006
Abstract: capuchin monkeys occupy a wide range of habitats where they feed on fruits, arthropods, and vertebrates. their large home ranges (80-900 ha) suggest that living in forest fragments may challenge their adaptability. we identified and quantified the main food items of cebus libidinosus spix, 1823 in forests fragments (100 ha) in southeastern brazil. we recorded the feeding activities of two groups using scan sampling over a 13-month period. the diet was composed of fruits, crops, animal prey, seeds, plant matter and undetermined. fruit was eaten more in the wet season than in the dry season, and maize and sugar cane consumption peaked in the early dry season. the proportion of fruit in the diet was positively correlated with fruiting intensity of zoochorous trees. the plant diet included 54 species, with maize, rhamnidium elaeocarpus, acrocomia aculeata, guazuma ulmifolia and cariniana, being most important. although dietary composition and diversity were similar to capuchins in larger forest fragments, feeding on crops attained higher percentages at times when zoochorous fruit production was low in fragments.
Peso flutuante no tratamento de mulheres obesas
Andrade Bárbara M. C.,Mendes Carlos M. Cardeal,Araújo Leila M. Batista
Arquivos Brasileiros de Endocrinologia & Metabologia , 2004,
Abstract: O tratamento da obesidade a longo prazo mostra que a maioria dos pacientes reganha peso, isto é, apresenta peso flutuante (PF). Estudamos a prevalência do PF (ganho e perda >5% do peso inicial, PI) em 218 mulheres selecionadas em um ambulatório de obesidade, com tempo mínimo de seguimento de 12 meses, no período entre 1992 e 2000. Foram excluídas pacientes com doen as psiquiátricas, infecciosas ou cr nicas (exceto síndrome metabólica), gravidez e uso de glucocorticóide. A idade média das pacientes foi 38±10 anos (18 a 68) e o IMC médio 41,0±6,6 kg/m2 (30 a 76). Todas foram tratadas com dieta hipocalórica e aumento da atividade física. Medica o anti-obesidade foi utilizada por 61% delas em curtos períodos de tempo. No acompanhamento de 28±16 meses (12 a 92), observou-se o PF em 62/218 (28,4%) das pacientes, das quais 53 perderam e posteriormente ganharam peso e 9 ganharam peso e depois perderam. Entre as cíclicas que inicialmente perderam peso, 59,1% recuperaram o peso no primeiro ano. O PF foi 2,4 mais freqüente naquelas com o consumo > 60g de álcool/semana em rela o àquelas com o consumo menor ou ausente (RR 2,4; 95%, IC= 1,2-4,7). N o houve associa o significante entre PF e classe de obesidade ou tabagismo. Concluímos que, nestas mulheres obesas, o PF apresentou elevada freqüência e o consumo de álcool foi um fator preditivo.
Avalia o das subclasses IgG1 e IgG3 na doen a hemolítica perinatal
Araújo Maria A.,Deffune Elenice,Carlos Luciana M. B.,Magalh?es Silvia M. M.
Revista Brasileira de Hematologia e Hemoterapia , 2003,
Abstract: A doen a hemolítica perinatal (DHPN) ainda é um problema clínico. Nenhum teste isolado prediz, com seguran a, a gravidade do quadro hemolítico. O objetivo do presente estudo foi determinar as subclasses de anticorpos IgG1 e IgG3 por citometria de fluxo no soro de 42 gestantes isoimunizadas e correlacionar os dados obtidos com a gravidade da DHPN. A distribui o dos fetos ou neonatos segundo a gravidade do quadro hemolítico evidenciou 13 casos com doen a leve, 16 casos com doen a moderada e 13 com doen a grave. As subclasses foram detectadas em 33/42 (79%) amostras. A subclasse IgG1, isoladamente, foi evidenciada em 14/33 (42,4%) casos. Na rela o entre gravidade da doen a e subclasses de IgG, observou-se que IgG1 isolada foi encontrada em todos os grupos, e os valores da mediana de intensidade de fluorescência (MIF) foram significativamente mais altos nas formas mais graves da DHPN (p<0,01). Contrariamente, os valores da MIF para IgG3 se apresentaram mais homogêneos em todas as categorias (p=0,11). A presen a de IgG3 parece, portanto, estar mais associada à hemólise leve. A associa o das subclasses IgG1 e IgG3 está relacionada à situa o clínica mais grave, o que se deve, possivelmente, à presen a de IgG1 associada. Apesar dos altos valores para IgG1 e a associa o de IgG1 com IgG3 indicarem maior gravidade da DHPN, sugere-se que outras variáveis sejam analisadas conjuntamente, uma vez que os relatos existentes na literatura, até o momento, n o d o suporte para seu uso como instrumento exclusivo de avalia o de gravidade e prognóstico da doen a.
TRANSFORMA O DO FOSFATO MONOCáLCICO EM FOSFATO BICáLCICO TRANSFORMATION OF MONOCALCIC PHOSPHATE IN BICALCIC PHOSPHATE
Nelson Calixto Milcken,Constantino B. de Oliveira,Carlos A. de Araújo,Celso Machado
Pesquisa Agropecuária Tropical , 2007, DOI: 10.5216/pat.v12i1.2418
Abstract: O Estado de Goiás é rico em fosfato monocálcico (de baixo pre o), o qual é usado como adubo. Com a finalidade de transformá-1o em fosfato bicálcico (de pre o elevado) e utilizá-lo na alimenta o de bovinos, desenvolveu-se nova técnica de obten o do bicálcico, à partir do monocálcico, e n o a partir da rocha fosfático ou da rea o do óxido de cálcio com ácido sulfúrico. A metodologia aplicada foi a seguinte: preparo das amostras visando a obtê-las com teores de acidez livre variando de 1 a 6 em fun o do ácido sulfúrico (amostras estas chamadas de T1, T2, ..... T6 respectivamente). Após obtidos os graus de acidez desejados, iniciaram-se os tratamentos térmicos das mesmas, ou seja, as amostras foram submetidas às temperaturas de 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 260, 280 e 300 graus centígrados durante tempos de exposi o de 20, 30 e 40 minutos. Finalmente, as amostras foram analisadas a fim de se obter os teores de P205 solúvel em água e em ácido cítrico a 2%. Pelas aná1ises desses teores, concluiu-se o seguinte: dos tratamentos efetivados, o que apresentou maior eficiência de transforma o do fosfato monocálcico para bicálcico foi o denominado de T1 com tempo de exposi o de 40 minutos sob a temperatura de 280°C. The state of Goiás is rich in monocalcic phosphate, which is used as fertilizer and has low price, in order to change it to bicalcic phosphate, which has high price and is used for cattle feeding. A new technique of bicalcic obtention was developed from the monocalcic, and not from the phosphatic rocks or from the calcium oxide reaction with sulphuric acid. The methodology applied was the following: Preparation of the samples trying to obtain them with contents of free acidity varying from one to six in function of sulphuric acid (samples which are called T1, T2......T6 respectively). After obtaining the wished degrees of acidity, the thermic treatment was given, that is, the samples were subjected to temperatures, such as 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 260, 280 and 300 degrees centigrade, in an exposition time of 20, 30 and 40 minutes. At the end, the samples were analyzed in order to dose the contents of soluble P205 in 2% citric acid. Through the analysis of these contents, it was concluded that from the treatments made, the most efficient method to transform the monocalcic phosphate in bicalcic was the 5 treatments with the exposition time of 40 minutes, under the temperature of 280°C.
Fulminant hepatic failure in children and adolescents in Northern Brazil
Fonseca José Carlos F.,Souza Rita A.B.,Brasil Leila M.,Araújo José R.
Revista da Sociedade Brasileira de Medicina Tropical , 2004,
Abstract: The histological findings of fulminant hepatic failure were correlated to the demographic, clinical, biochemical and virological features in children and adolescents, native to the Amazonas State in Northern Brazil. 96.2% had evidence of infection by primary hepatotrophic viruses. Histological analysis revealed three distinct patterns of fulminant hepatic failure.
Page 1 /213973
Display every page Item


Home
Copyright © 2008-2017 Open Access Library. All rights reserved.