oalib

Publish in OALib Journal

ISSN: 2333-9721

APC: Only $99

Submit

Any time

2019 ( 7 )

2018 ( 22 )

2017 ( 12 )

2016 ( 21 )

Custom range...

Search Results: 1 - 10 of 14793 matches for " Astolfi-Filho Spártaco "
All listed articles are free for downloading (OA Articles)
Page 1 /14793
Display every page Item
Use of AFLPS to distinguish landraces of pejibaye (Bactris gasipaes) in brazilian Amazonia
Clement Charles R.,Sousa Nelcimar Reis,Rodrigues Doriane Pican?o,Astolfi-Filho Spártaco
Scientia Agricola , 2002,
Abstract: Although the first inhabitants of western Amazonia domesticated pejibaye (Bactris gasipaes Kunth, Palmae) or peach palm for its fruits, today it is widely planted for its heart-of-palm. Like other domesticates, pejibaye presents a complex hierarchy of landraces developed before the conquest of the Americas. The existence of three landraces (Pará, Solim es, Putumayo) was proposed along the Amazonas and Solim es Rivers, Brazil, based on morphological characteristics. There are some questions remaining about the intermediate landrace being an artifact of the morphometric analysis. AFLPs were used to evaluate the relationships among samples of these putative landraces. DNA was extracted from 99 plants representing 13 populations maintained in the Pejibaye Germplasm Bank, Manaus, AM; six primer combinations generated 245 markers via PCR, which were scored in an ABI Prism 310 sequencer and analyzed with GeneScan Software; Jaccard similarities were estimated and a dendrogram was generated with UPGMA. Two groups of plants were observed in the dendrogram instead of three, and were similar at 0.795. Each group contained two subgroups, similar at 0.815. One group (n=41) contained 73% Pará landrace plants, with one subgroup (n=22) containing 91% Pará, and the other (n=19) containing 53% Pará. The other group (n=58) contained 53% Solim es and 40% Putumayo landrace plants, with one subgroup (n=21) containing 52% Solim es and 43% Putumayo, and the other (n=35) containing 57% Solim es and 37% Putumayo. The first group confirmed the Pará landrace. The second group suggested that the Solim es landrace does not exist, but that the Putumayo landrace extends along the Solim es River to Central Amazonia.
Use of AFLPS to distinguish landraces of pejibaye (Bactris gasipaes) in brazilian Amazonia
Clement, Charles R.;Sousa, Nelcimar Reis;Rodrigues, Doriane Pican?o;Astolfi-Filho, Spártaco;Moreno, Yolanda Nú?ez;Pascual, Vicente Torres;Rodríguez, Francisco Javier Gallego;
Scientia Agricola , 2002, DOI: 10.1590/S0103-90162002000400019
Abstract: although the first inhabitants of western amazonia domesticated pejibaye (bactris gasipaes kunth, palmae) or peach palm for its fruits, today it is widely planted for its heart-of-palm. like other domesticates, pejibaye presents a complex hierarchy of landraces developed before the conquest of the americas. the existence of three landraces (pará, solim?es, putumayo) was proposed along the amazonas and solim?es rivers, brazil, based on morphological characteristics. there are some questions remaining about the intermediate landrace being an artifact of the morphometric analysis. aflps were used to evaluate the relationships among samples of these putative landraces. dna was extracted from 99 plants representing 13 populations maintained in the pejibaye germplasm bank, manaus, am; six primer combinations generated 245 markers via pcr, which were scored in an abi prism 310 sequencer and analyzed with genescan software; jaccard similarities were estimated and a dendrogram was generated with upgma. two groups of plants were observed in the dendrogram instead of three, and were similar at 0.795. each group contained two subgroups, similar at 0.815. one group (n=41) contained 73% pará landrace plants, with one subgroup (n=22) containing 91% pará, and the other (n=19) containing 53% pará. the other group (n=58) contained 53% solim?es and 40% putumayo landrace plants, with one subgroup (n=21) containing 52% solim?es and 43% putumayo, and the other (n=35) containing 57% solim?es and 37% putumayo. the first group confirmed the pará landrace. the second group suggested that the solim?es landrace does not exist, but that the putumayo landrace extends along the solim?es river to central amazonia.
Detection of Chlamydia trachomatis in endocervical smears of sexually active women in Manaus-AM, Brazil, by PCR
Santos, Cristina;Teixeira, Fabiane;Vicente, Ana;Astolfi-Filho, Spartaco;
Brazilian Journal of Infectious Diseases , 2003, DOI: 10.1590/S1413-86702003000200001
Abstract: chlamydia trachomatis is now one of the most prevalent bacteria found in classic sexually transmissible diseases (std), and as such, constitutes a serious public health problem. we examined the prevalence of chlamydia trachomatis, by polymerase chain reaction (pcr), in 121 sexually active women who sought treatment for std in the alfredo da matta institute of dermatology and venerology and the institute of tropical medicine of amazonas in manaus, brazil. these women were examined by a specific pcr for the chlamydial plasmid, and the nature of the amplicon was determined by restriction analysis and dna sequencing. the pcr diagnosis revealed a prevalence of 20.7% infected women.
Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting
ANUNCIA??O, CARLOS EDUARDO;ASTOLFI-FILHO, SPARTACO;
Pesquisa Agropecuária Brasileira , 2000, DOI: 10.1590/S0100-204X2000001000012
Abstract: gc-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. in this study new dna sequences were isolated which could be used in paternity tests in horses. genomic dna from "mangalarga-marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. four clones (s01, s05, s07 and s09) selected from a genomic library screened with a (tg)n oligonucleotide showed similar hybridization profiles generating bands of dna-fingerprinting type. using these probes the individualization power obtained was 10-8, which is 105fold higher than that obtained with m13, another gc-rich type probe. all clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, gtttcatttattattctttggaagaaa, which was repeated 12, 18, 11 and 21 times in clones s01, s05, s07 and s09, respectively.
Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting
ANUNCIA??O CARLOS EDUARDO,ASTOLFI-FILHO SPARTACO
Pesquisa Agropecuária Brasileira , 2000,
Abstract: GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Detection of Chlamydia trachomatis in endocervical smears of sexually active women in Manaus-AM, Brazil, by PCR
Santos Cristina,Teixeira Fabiane,Vicente Ana,Astolfi-Filho Spartaco
Brazilian Journal of Infectious Diseases , 2003,
Abstract: Chlamydia trachomatis is now one of the most prevalent bacteria found in classic sexually transmissible diseases (STD), and as such, constitutes a serious public health problem. We examined the prevalence of Chlamydia trachomatis, by polymerase chain reaction (PCR), in 121 sexually active women who sought treatment for STD in the Alfredo da Matta Institute of Dermatology and Venerology and the Institute of Tropical Medicine of Amazonas in Manaus, Brazil. These women were examined by a specific PCR for the chlamydial plasmid, and the nature of the amplicon was determined by restriction analysis and DNA sequencing. The PCR diagnosis revealed a prevalence of 20.7% infected women.
Anticoagulant activity in salivary gland homogenates of Thyrsopelma guianense (Diptera: Simuliidae), the primary vector of onchocerciasis in the Brazilian Amazon
Chagas, Andrezza Campos;Medeiros, Jansen Fernandes;Astolfi-Filho, Spartaco;Py-Daniel, Victor;
Memórias do Instituto Oswaldo Cruz , 2010, DOI: 10.1590/S0074-02762010000200011
Abstract: in this study, anticoagulant activity was detected in salivary gland homogenates (sghs) of thyrsopelma guianense (diptera: simuliidae). the sgh yielded 1.07 μg ± 0.03 (n = 15) of total soluble protein per pair of glands. in addition, following sds-page (12.5% gel) and silver nitrate staining, 12 polypeptides with molecular weights ranging from 14-69 kda were detected in all physiological ages analyzed (12 h, 24 h, 48 h and 72 h following emergence). coagulation bioassays showed that the sghs had activities that interacted at all levels of coagulation (the intrinsic, extrinsic and common pathways), by extending the plasma recalcification time, prothrombin time, thrombin time. this is the first report on the activity of salivary gland proteins from the main vector of onchocerciasis in brazil. we also suggest detailed studies on the morphology and function of the salivary glands in order to understand the role of these proteins in host/vector interactions.
Encapsula??o de suco de maracujá por co-cristaliza??o com sacarose: cinética de cristaliza??o e propriedades físicas
Astolfi-Filho, Zailer;Souza, Ana C.;Reipert, érika C. D.;Telis, Vania R. N.;
Ciência e Tecnologia de Alimentos , 2005, DOI: 10.1590/S0101-20612005000400027
Abstract: co-crystallization is an encapsulation process where a second ingredient is incorporated in a porous conglomerate of sucrose microcrystals formed by spontaneous crystallization. the process is carried out by concentrating a sucrose syrup until supersaturation and, then, adding the core material, with the mixture being submitted to an intensive agitation that leads to nucleation and product agglomeration. in the present work, encapsulation of passion fruit concentrated juice by co-crystallization with sucrose was evaluated by determining the effects of added juice fraction and juice ph on moisture content, solubility, apparent density and repose angle of final product, as well as by following the co-crystallization kinetics in a rheo-reactor, constituted of a crystallizer adapted to a concentric cylinders rotational rheometer, in which an agitator substitutes for the internal cylinder. the cocrystallization kinetics was described by an empirical model fitted to experimental data and the crystallization rate was accelerated with increasing ph and decreasing added juice fraction. the co-crystallized products presented lower moisture content and higher solubility at lower juice fractions. apparent density and repose angle were similar to those reported for the encapsulating matrix and were in the range of values reported for most of food powders.
BpuAmI: a novel SacI neoschizomer from Bacillus pumilus discovered in an isolate from Amazon Basin, recognizing 5'-GAGˉCTC-3'
Chies, Jocelei M.;Dias, Ana C. de O.;Maia, Hélio M.M.;Astolfi-Filho, Spartaco;
Brazilian Journal of Microbiology , 2006, DOI: 10.1590/S1517-83822006000100018
Abstract: a strain of bacillus pumilus was isolated and identified from water samples collected from a small affluent of the amazon river. type ii restriction endonuclease activity was detected in these bacteria. the enzyme was purified and the molecular weight of the native protein estimated by gel filtration and sds-page. the optimum ph, temperature and salt requirements were determined. quality control assays showed the complete absence of "nonspecific nucleases." restriction cleavage analysis and dna sequencing of restriction fragments allowed the unequivocal demonstration of 5′gagˉctc3′ as the recognition sequence. this enzyme was named bpuami and is apparently a neoschizomer of the prototype restriction endonuclease saci. this is the first report of an isoschizomer and/or neoschizomer of the prototype saci identified in the genus bacillus.
Analysis of Chromobacterium sp. natural isolates from different Brazilian ecosystems
Cláudia I Lima-Bittencourt, Spartaco Astolfi-Filho, Edmar Chartone-Souza, Fabrício R Santos, Andréa MA Nascimento
BMC Microbiology , 2007, DOI: 10.1186/1471-2180-7-58
Abstract: In general, the clusters based on physiological profiles included isolates from two or more geographical locations indicating that they are not restricted to a single ecosystem. The isolates from Brazilian Savannah presented greater physiologic diversity and their biochemical profile was the most variable of all groupings. The isolates recovered from Amazon and Atlantic Rain Forests presented the most similar biochemical characteristics to the Chromobacterium violaceum ATCC 12472 strain. Clusters based on biochemical profiles were congruent with clusters obtained by the 16S rRNA gene tree. According to the phylogenetic analyses, isolates from the Amazon Rain Forest and Savannah displayed a closer relationship to the Chromobacterium violaceum ATCC 12472. Furthermore, 16S rRNA gene tree revealed a good correlation between phylogenetic clustering and geographic origin.The physiological analyses clearly demonstrate the high biochemical versatility found in the C. violaceum genome and molecular methods allowed to detect the intra and inter-population diversity of isolates from three Brazilian ecosystems.Chromobacterium violaceum is a Gram-negative bacterium found in the environment as a saprophyte, in a wide variety of tropical and subtropical ecosystems, primarily in water and soil [1]. It is a β-Proteobacterium that is of great biotechnological interest due to its wide potential for industrial, pharmacological and ecological use [2].This free-living bacterium presents a high flexibility to survive in the most diverse environments [3]. Its biological characteristics make C. violaceum a major component of the microbiota in tropical ecosystems. In Brazil, C. violaceum is present in three main ecosystems: the Amazon Rain Forest (AmF) [4], the Brazilian Savannah (BS), also called Cerrado, and the Atlantic Rain Forest (AtF), which are considered biodiversity hotspots [5]. These three ecosystems encompass altogether almost 50% of the total area in the Neotropical region.The c
Page 1 /14793
Display every page Item


Home
Copyright © 2008-2017 Open Access Library. All rights reserved.