oalib

Publish in OALib Journal

ISSN: 2333-9721

APC: Only $99

Submit

Search Results: 1 - 10 of 401 matches for " Afzal Dogar "
All listed articles are free for downloading (OA Articles)
Page 1 /401
Display every page Item
RNAi dependent epigenetic marks on a geminivirus promoter
Afzal Dogar
Virology Journal , 2006, DOI: 10.1186/1743-422x-3-5
Abstract: In plants RNA interference or post transcriptional gene silencing (PTGS) acts as a natural anti-viral defense system for neutralizing pathogenic nucleic acids either through a change in RNA stability in the cytoplasm or through mechanisms that use the RNA itself to induce methylation and silencing of homologous nuclear genes [1]. In addition there are more than one Dicer and Argonaute proteins in plants e.g. Arabidopsis genome encodes four Dicers [2] and ten Argonate orthologs [3]. Geminiviruses are single-stranded circular DNA viruses that cause economically significant diseases in a wide range of crop plants worldwide [4]. They replicate in the plant cell nuclei through transcription and replication competent double stranded DNA intermediate, which is packed into nucleosomes from host cells [5]. In plants, some geminivirus-host interactions naturally lead to host recovery e.g. natural recovery response induced by ACMV-infected N. benthamiana and cassava involves siRNAs originating from geminivirus genome [6]. However the affect of siRNAs at the virus genome remained to be seen. Here I show multiple siRNAs species in transgenic plants direct the methylation of ACMV DNA A as well as the methylation at lysine-9 residues of histone H3 wrapping the promoter region in the virus genome.A 360 nucleotides fragment corresponding to the intergenic region of ACMV DNA A (GenBank: NC_001467) was cloned in sense and anti-sense orientation interrupted with a synthetic plant intron. The left arm KpnI-ClaI and right arm XhoI-BamI fragments were PCR amplifed and cloned into dsproA VMYMV- int vector [7]. The EcoRI-XbaI fragment of this vector was cloned into pCambia 1300. The following primers used for amplification the left arm (KpnI F: GGTACCAATCTCAACTAGAGACACTCTTGA) and (ClaI R: ATCGATGCACAAATATTTAATTGCCAG), and the right arm (XhoI F: CTCGACGCAGTTTATAAATTAACGGGTC) and (BamHI R: GGATCCAATGAGTTGATCTCTGTGAGAACT). The resulting binary construct was introduced into Agrobacterium tumefa
DRUG ABUSE
IMTIAZ AHMAD DOGAR
The Professional Medical Journal , 2005,
Abstract: Background: Drug abuse is one of the major problems facing the worldtoday. Care providers and clinicians are faced with ever changing patterns of drug abuse and hence need to stayabreast of the latest developments. Research in this area in Pakistan is direly needed. Aims: This study wasundertaken with an idea of collecting basic data to assess the extent and variety of drug abuse in patients presentingto the researchers, and to assess the changes during a five-year interval. Design of study: Non-interventionalcomparative study. Setting: Department of Psychiatry, District Headquarters Hospital, Faisalabad Period: From1996to 2001. Materials & Methods: The sample consisted of patients admitted for treatment in the years 1996 & 2001.Statistical analysis was carried out using the software package SSPS utilizing tests such as the chi square andstudent’s t-test. Results: In this department, drug abuse is more frequently reported among urban, literate, marriedmales during young adulthood. Tobacco and cannabis are most frequently reported. Sex, curiosity and peer pressureare the main motivations involved in starting drug abuse. Besides these stable findings, some changes have occurredduring five years; polydrug abuse has become more frequent and the socioeconomic status of this patient group isdeteriorating. Conclusions: The problem of drug abuse is still rampant, if not increasing with time. The patterns of drugabuse are becoming more complicated, posing new challenges for health care planners and providers. More researchneeds to be undertaken in this area.
ETIOLOGICAL GENDER DIFFERENCES IN PSYCHIATRIC DISORDERS
IMTIAZ AHMAD DOGAR
The Professional Medical Journal , 2006,
Abstract: Background: Recent studies have shown particular differences foundin both gender neurotic disorders but not in psychotic disorders with regard to environmental factors. But research inthis area in Pakistan is direly needed. Aims & Objectives: To find out what gender; either male or female more affectfrom environmental factors whether they are susceptible of that disorder or not and to find out the “etiology of genderdifferences in psychological disorder”. Design: Non-interventional comparative study. Setting: Department ofPsychiatry, District Headquarters Hospital, Faisalabad. Period: From May 2005 to Oct 2005. Material and Methods:A total of 80 patients of all ages are taken from in which we divide the sample i.e. each disorder comprises of 20patients 10 male and 10 females. The Hospital that used is DHQ Hospital Faisalabad. We have used the randomselection. The study is comprises of patient having Mood disorder, Anxiety, schizophrenia and personality disorder.For the simple analysis of data, percentages were applied for the statistical analysis. Results: The result showed thathypothesis is supported because there are significant differences (i.e. 42.5% > 30%) found as environmental factorsaffect more universally on females. Conclusion: Environmental factors affect more in women psychological health.Etiological gender differences in psychological disorders with special reference of mood disorder, anxiety disorder,schizophrenia and personality disorders are real and these gender differences may be due to their both nature ornurture gender. There are significant etiological gender differences in neurotic disorders i.e. Depression and anxietydisorder and minor difference in psychotic disorders i.e. Schizophrenia and mania.
GROUND WATER IN SOUTHERN AREAS OF FAISALABAD
ZAHOOR UL HASSAN DOGAR
The Professional Medical Journal , 2004,
Abstract: Objective: To evaluate biochemically the water pollutionby estimating various quality parameters of ground water supply available in the southern area ofFaisalabad. Design: Prospective study Setting: Biochemistry Department Punjab Medical CollegeFaisalabad and Soil Research laboratory of AARI Jhang Road Faisalabad. Duration: May 2000 toSeptember 2000 Material & Methods: Different parameters were divided into three different categoriesi.e. Highly-desirable(HD), Maximum-permissible(MP) and In-Tolerant(IT) limit groups. Results: TotalHardness(HD) showed 35% in HD, 40% in MP and 25% in IT limits. Similarly Total Dissolved Solids(TDS) were 23% in HD, 52% in MP and 25% in IT range The Ca was 30%in HD, 50% in MP and 20%in IT limits. The Mg showed 50% in HD, 38% in MP and 12% in IT range. Similarly Cl was, 45% in HD,32% in MP and 23% in IT range. Lastly SO4 percentage showed 45% in HD, 37.5% in MP and only17.5% in IT limit. Conclusions: The result showed that people living in Bawaywala area were consuminghighly polluted water and similarly the peoples of other colonies are using more or less the same typeof water.
USE OF ECONOMETRIC INSTRUMENTS IN DETERMINING THE FINANCIAL RESOURCES NEEDED FOR PROFESSIONAL SKILLS DEVELOPMENT PROJECTS
Dogar Cristian,Kelemen Andrei
Annals of the University of Oradea : Economic Science , 2010,
Abstract: The market shows no signs of sustainable recovery after the crisis that hit the world economy in 2007, and therefore public intervention in the area of professional re-conversion is highly desirable. Public spending on training programs needs to be economically justified and closely monitored. We describe an econometric method to evaluate needed costs for training programs for professional skills development, based on a sample of pair values extracted from training projects implemented between 2008 and 2009. We find that, although the unitary value as resulted after applying the econometric model corresponds to the national available amount, by applying other types of indicators, such hour of training, can determine more efficient (less resources needed), cost-effective and effective (increased number of trained individuals for less costs) values in what regards the process of delivering training programs.
Design and Development of Weather Monitoring and Controlling System for a Smart Agro (Farm)  [PDF]
Sumya Tabassum, Afzal Hossain
Intelligent Control and Automation (ICA) , 2018, DOI: 10.4236/ica.2018.93005
Abstract: Weather plays an important role in our farming system. In greenhouse or internal farming system, weather monitoring is important. For better production and maintenance, it is important to monitor. This project is developed for forecasting weather parameters like humidity, temperature, soil moisture, and raid detection. Humidity and temperature are monitored for internal temperature. The soil is the most important part of a greenhouse. In this project, soil moisture level is monitored and controlled for maintaining soil moisture level. Rain detection is used in outside of the farm. It detects rainwater and sends a message to the server. It is monitored by using a local server. In remote routing area, it also can be monitored and controlled without physical existence. Also, it is a low-cost weather monitoring system for the agro farm. The Raspberry Pi is a low cost, credit-card sized computer that plugs into a computer monitor or TV, and uses a standard keyboard and mouse. The monitoring system could be designed by using the sensor. It is useful for forecasting and data analysis process. In this project weather forecasting system is designed by using a sensor. In this project, Raspberry Pi work like a remote monitoring and controlling system for the agro farm.
BLOOD CHOLESTEROL
M Zahoor ul Hassan Dogar
The Professional Medical Journal , 2000,
Abstract: OBJECTIVE: To find out the effect of vitamin C deficiency on different fractions of blood cholesterol anddevelopment of hypertension. DESIGN: Prospective comparative study. SETTING: Punjab Institute ofCardiology Lahore. PERIOD: From Oct 1995 to Oct 1996. SUBJECTS AND METHODS: Ninety fourmale adults (sixty three hypertensive and thirty one normotensive) subjects of 40-55 years age. RESULTS:The plasma ascorbic acid (PAA) levels were 0.530±0.086 mg/dl, 0.374±0.68 mg/dl and 0.218±0.077 mg/dlin the normotensive, mild and moderate hypertensive subjects. The Total Cholesterol (TC) was 182.37±24.08mg/dl, 205.96±15.79 mg/dl and 261.45±57.40 mg/dl in the above groups. Similarly the serum levels of HDLCholesterol (HDL-C) were 45.25±4.35 mg/dl, 42.36±2.76 mg/dl and 37.66±3.45 mg/dl and LDL Cholesterol(LDL-C) levels were 102.49±29.07 mg/dl, 128.98±21.69 mg/dl and 175.32±63.72 mg/dl respectively. Theresults of blood ascorbic acid along with various fractions of cholesterol, were significantly differed in theabove groups and the data indicated clearly that PAA (r=-10.891) and HDL-C (r=-0.658) were correlatednegatively while TC (r=+0.616) and LDL-C (r=+0.562) were related positively with the diastolic blood pressure.The results also showed that Plasma Ascorbic Acid (PAA) was correlated negatively with the TC and LDL-Cand positively with the HDL-C levels. CONCLUSIONS: It is suggested that plasma ascorbic acid deficiencymay be responsible for derangements of various fractions of cholesterol resulting in atherogenic vasculardamage leading to hypertension.
VIRAL HEPATITIS
M. Zahoor ul Hassan Dogar
The Professional Medical Journal , 2001,
Abstract: Viral Hepatitis “An AIDS of Pakistan”, a poster exhibited on a local walk against Hepatitis, depictsthe severity of the disease. A survey published recently in a daily newspaper narrated that about10-25% of total population in Pakistan is either suffering from, or is included among carrier ofthis disease. Among them, the common prevalent types are hepatitis B & C. This article is a reviewcompilation of the various research materials published in international journals, related actually to Pakistanor Pakistani population settled elsewhere in the world.
MICROMINERAL STATUS; EVALUATION OF SERUM IRON AND ZINC IN YOUNG HEALTHY INDIVIDUALS OF LOCAL POPULATION
M. Zahoor ul Hassan Dogar
The Professional Medical Journal , 1997,
Abstract: The study was designed to evaluate the serum iron and zinc status of young healthy individuals with the views toset some physiological norms for reference use in future. Seventy one young healthy medical students (17-25 Yearsage) of Punjab Medical College Faisalabad (residing in hostel almost on a uniform diet) were evaluated for serumiron and zinc status. The estimation of serum iron and zinc were done using an atomic absorptionspectrophotometer. The mean serum iron levels were 102.54±14.36 ug/dl 107.60± 15.96 ug/dl and 112.12+16.34ug/dl, in 17-19 years, 20-22 years and 23-25 years of age respectively. The main serum zinc levels were 75.10±12.10 ug/dl, 78.40+ 12.90 ug/dl and 79.90± 12.20 ug/dl in different age groups. When the data was evaluatedaccording to the sex, it was found that serum iron and zinc levels in males were 108.40±16.42 ug/dl and79.62±14.22 ug/dl respectively. Similarly the levels were 99.68± 13.46 ug/dl and 72.52+8.76 ug/dl in females.
PLASMA ASCORBIC ACID DEFICIENCY
M. Zahoor Ul Hassan Dogar
The Professional Medical Journal , 1999,
Abstract: OBJECTIVE: To find out ascorbic acid deficiency as a possible causative factor in development ofessential hypertension. DESIGN: Prospective study. SETTING: Punjab Institute of Cardiology, Lahore.PATIENTS AND METHODS: Fifty two male patients of essential hypertension (mild and moderate)between 40-55 years age were selected. Thirty one other healthy individuals of te same age and sex were alsoincluded in the study as controls. RESULTS: The mean plasma ascorbic acid levels were found to be0.540±0.086 mg/dl, 0.372±0.068 and 0.216±0.077 mg/dl in normotensive control, mild and moderateessential hypertensive subjects, respectively. The data showed that PAA levels were significantly differentin different groups depending upon the levels of blood pressure, being highest at lowest levels of bloodpressure. The study showed that plasma ascorbic acid concentration had a moderate independent , inverseassociation with the systolic ( r = 0.891) and diastolic ( r = 0.826) blood pressure. CONCLUSIONS: Thprevalence of systolic and diastolic hypertension increase with decrease in plasma ascorbic acid. The datasuggested that plasma ascorbic acid deficiency may be one of the cause of essential hypertension in middleage male adults.
Page 1 /401
Display every page Item


Home
Copyright © 2008-2017 Open Access Library. All rights reserved.