oalib

Publish in OALib Journal

ISSN: 2333-9721

APC: Only $99

Submit

Any time

4 ( 1 )

2020 ( 4 )

2019 ( 261 )

2018 ( 289 )

Custom range...

Search Results: 1 - 10 of 121934 matches for " Jo?o Arag?o "
All listed articles are free for downloading (OA Articles)
Page 1 /121934
Display every page Item
Prevalence of Burnout among Professionals Who Care for Elderly and Chronically Ill Patients  [PDF]
Carla Susana Vicente, Rui Arago Oliveira, Joo Maroco
Psychology (PSYCH) , 2014, DOI: 10.4236/psych.2014.517196
Abstract: This study aims to evaluate the prevalence of Burnout Syndrome among professionals who care for elderly and chronically ill patients and the relationship between the appearance of Burnout and sociodemographic and job related variables. The sample consisted of 265 employees who worked directly with the elderly and chronically ill. It was composed mostly of women, 94.3%. The average age was 43 (SD = 10.2). We made use of the following instruments: a sociodemographic questionnaire and the Maslach Burnout Inventory—HSS (Semedo, 2009). The results show that 19.6% of participants have high rates of emotional exhaustion, 4.9% present high depersonalization, and 2.6% experience low personal accomplishment. Disease severity and support services influence personal accomplishment. Age proved to be a predictor of the emotional exhaustion variable, while the length of service at an institution variable not only proved to be a predictor of emotional exhaustion, but also of personal accomplishment. The prevention of Burnout Syndrome constitutes one of the major challenges for occupational health care providers to the elderly and chronically ill.
Caracteriza??o morfológica de germoplasma de alho por análises multivariada componentes principais e variáveis can?nicas
Menezes Sobrinho, Joo A. de;Charchar, Joo M.;Arago, Fernando A. S.;
Horticultura Brasileira , 1999, DOI: 10.1590/S0102-05361999000200004
Abstract: the garlic germplasm collection maintained by embrapa hortali?as comprises 89 accessions, representing the genetic diversity of this crop in the country. duplicates of the same genotype increase the cost of maintaining the collection, as well as make difficult their agronomic evaluation. the identification of duplicated accessions of the garlic germoplasm active bank was obtained through analysis of 27 variables of morphological characteristics. genotypic differentiation among thirteen groups was achieved by cluster analysis. the most important features for distinction of these groups through principal components analysis were: plant height with erect leaves at 60 days; plant height with normal leaves at 60 days; leaf insertion angle at 90 days; bulb colour; number of bulblets from sieves one, two, and four; weight of bulblets from sieve two; average weight of bulbs at harvest time; and average bulb weight at threshing time. the most important features for the distinction of group genotype representatives by canonic variables analysis were: plant height with erect leaves at 120 days; plant height with normal leaves at 60 days; leaf insertion angle at 90 days; number of leaves at 60 and 90 days; number of bulbs at harvest time; total number of bulbs; average weight of plants at first day and at 60 days; and average weight of bulbs. genotype representatives of different groups were distinctly characterised on the basis of 34 parameters, complemented by canonic variables analysis.
Falciform ligament abscess: report of a case
Melo Valdinaldo Arago de,Melo Gustavo Barreto de,Silva Renata Lemos,Arago Joo Fernandes Britto
Revista do Hospital das Clínicas , 2003,
Abstract: Falciform ligament abscess is rare. We report a case of a 65-year-old man who presented with right upper quadrant abdominal pain, postprandial fullness, and fever. Computed tomography disclosed a cylindrical mass in the anterior abdomen that aroused suspicion of a hepatic abscess. At laparoscopic surgery, an abscess of the falciform ligament was found and drained. Two months later, the patient developed recurrence of the abscess secondary to acute calculous cholecystitis. Abscess drainage and cholecystectomy were performed. The presence of right uppper quadrant abdominal pain, epigastric tenderness, fever, leukocytosis, and a mass in the anterior abdomen should arouse suspicion of falciform ligament abscess. Its treatment consists of abscess drainage.
Padroniza o da metodologia do RT-PCR utilizado para identifica o do mRNA da alfa-amilase em sementes de milho RT-PCR patterning for alpha-amylase messenger RNA identification in germinating maize seeds
Bárbara Fran?a Dantas,Carlos Alberto Arago,Joo Pessoa Araújo-Junior,Joo Domingos Rodrigues
Revista Brasileira de Sementes , 2002,
Abstract: Durante a germina o das sementes, os carboidratos de reserva s o degradados pela atividade de a-amilase. A identifica o de mRNA é uma ferramenta fundamental para a defini o da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germina o das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modifica es. A partir do RNA total extraído foi obtido cDNA com utiliza o de "random primers". A amplifica o por PCR de uma por o do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por rea o e completados com água tratada com DEPC. Os ciclos para a amplifica o foram 94oC durante 4 minutos, seguidos por 34 ciclos de 94oC durante 1 minuto, 42oC durante 1 minuto e 72oC durante 1,5 minutos e, finalmente, 72oC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, n o ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identifica o da express o de alfa-amilase durante a germina o das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germina o. During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction method, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94oC/4 minutes, 34 cycles of 94oC /1 minute, 42oC/1 minute and 72oC/1,5 minutes, and finally 72oC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands.
Propofol and N-Acetylcysteine attenuate oxidative stress induced by intestinal ischemia/reperfusion in rats: Protein carbonyl detection by immunoblotting
Azeredo, Marcelo Arago Insuellas de;Azeredo, Luciana Arago Insuellas de;Eleuthério, Elis Cristina Araújo;Schanaider, Alberto;
Acta Cirurgica Brasileira , 2008, DOI: 10.1590/S0102-86502008000500006
Abstract: purpose: to evaluate the antioxidant effect of propofol and n-acetylcysteine (nac) on intestinal ischemia/reperfusion (i/r) in rats by determining carbonyl protein level. methods: forty wistar rats were randomly assigned into the following groups: control; sham; i/r with propofol; i/r with propofol and nac; i/r with ketamine and xylazine. the i/r groups underwent 60 minutes of ischemia and an equal period of reperfusion. blood samples, collected by cardiac punction, were centrifuged for plasma obtainment. protein carbonyl level in plasma samples was determined by immunoblotting. results: no significant difference in protein carbonyl level was found between control and sham groups (p>0.05). the highest reduction in protein carbonyl level (p<0.05) was obtained with the administration of propofol and nac (group 4) in intestinal i/r procedure. conclusion: the administration of propofol and nac showed the best antioxidant effect on oxidative stress in rats that underwent intestinal i/r procedure, suggesting a synergistic interaction.
Padroniza??o da metodologia do RT-PCR utilizado para identifica??o do mRNA da alfa-amilase em sementes de milho
Dantas, Bárbara Fran?a;Arago, Carlos Alberto;Araújo-Junior, Joo Pessoa;Rodrigues, Joo Domingos;Cavariani, Cláudio;Nakagawa, Joo;
Revista Brasileira de Sementes , 2002, DOI: 10.1590/S0101-31222002000100019
Abstract: during germination the seed reserve carbohydrates are degraded by a-amylase activity. the identification of mrna is a very important tool for definition of a-amylase synthesis kinetics. this study aimed to adapt a pt-pcr methodology for a-identification of amylase mrna in germinating maize seeds. after three days germination of saracura brs4154 and cati al34 maize cultivars, the total rna was isolated by the guanidinium thiocyanate-phenol-chloroform extraction method, with some modifications. the cdna was obtained from the total rna, using random primers. the a-amylase gene pcr amplification was carried out with cdna, primers (sense - cgacatcgaccacctcaac; antisense - ttgaccagctcctgcctgtc); gelatina; dmso and 1,25 units of taq dna polimerase per reaction and complete with depc water. the amplification cycles were 94oc/4 minutes, 34 cycles of 94oc /1 minute, 42oc/1 minute and 72oc/1,5 minutes, and finally 72oc/5 minutes. the rt-pcr product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands. the rt-pcr is an eficient method for a-amylase expression studies during germination and can be used as a tool for quantitative and qualitative research about a-amylase sinthesis kinetics.
Estudo da audi??o de crian?as de gestantes expostas ao ruído ocupacional: avalia??o por emiss?es otoacústicas - produto de distor??o
Rocha, Eduardo Bezerra;Azevedo, Marisa Frasson de;Ximenes Filho, Joo Arago;
Revista Brasileira de Otorrinolaringologia , 2007, DOI: 10.1590/S0034-72992007000300011
Abstract: aim: to detect early on a probable hearing loss in children of women exposed to occupational noise during their pregnancy and to verify if there is any difference between the children from those women exposed to occupational noise during their pregnancy and the ones from mothers that do not work under the same conditions. methods: children from women exposed to occupational noise during their pregnancy and children from women who were not exposed were evaluated through distortion product otoacoustic emissions, using the gsi 60 dpoea system equipment and the frequency-ratio f2/f1 equal to 1.2 and the geometric average of 2f1-f2. the intensity of the primary frequencies were kept steady with values of l1=65dbspl and l2=55dbspl for f1 and f2, respectively. student t test in paired samples and independent samples were used. results: there were no differences in the response amplitude of distortion product otoacoustic emissions between the control and the study groups. there was no statistically difference between male and female children in response amplitude for the two groups aforementioned; and there were no differences between right and left ears from each group. conclusion: we did not observe hearing impairment in children whose mothers were exposed to occupational noise during pregnancy when compared to the children from mothers who were not. there was no difference between the right and left ears, nor between male and female children in each group.
Residência médica em otorrinolaringologia no Ceará em 2003: oferta de vagas e perfil da concorrência
Ximenes Filho, Joo Arago;Silva, Marcelo Gurgel Carlos da;
Revista Brasileira de Otorrinolaringologia , 2006, DOI: 10.1590/S0034-72992006000600015
Abstract: aim: analyze and compare the openings for medical residency in otorhinolaryngology in ceará in 2003 along with the profile of the applicants. stud design: cross-sectional. methods: data on medical residency programs in ceará as of september 2003 were obtained electronically from the web page of the national commission of medical residency (cnrm). the information regarding the applicants was retrieved directly from the institutions offering medical residency programs in otorhinolaryngology in 2003 and complemented by searches in the databases of the ceará state regional council of medicine and the federal council of medicine. results: the total number of openings in otorhinolaryngology authorized by cnrm is 12. nine (75%) of the total and 4 (100%) of first year residence are currently filled. the hospital occupancy rate was 66.67% for hgf and 83.33% for huwc. competition per residency was 13.0 at both hospitals. the 48 applications received by the two hospitals were submitted by 37 doctors, 66.67% of whom were male. the largest number of candidates came from the medical schools of the federal universities of ceará (62.50%), paraíba (15.63%) and alagoas (9.38%). approximately 41% of the candidates had graduated in 2002. conclusion: this study presents a profile of medical residency in otorhinolaryngology.
Papilomatose laríngea recorrente: experiência de 10 anos
Ximenes Filho, Joo Arago;Simoceli, Lucinda;Imamura, Rui;Tsuji, Domingos Hiroshi;Sennes, Luiz Ubirajara;
Revista Brasileira de Otorrinolaringologia , 2003, DOI: 10.1590/S0034-72992003000500003
Abstract: introduction: airway papillomas are benign tumors with high recurrence and induced by virus. papillomatosis's etiology is related with papilloma human virus infection. two clinical forms are described: juvenile and adult. objective: the aim of this study was to compare the two clinical forms of the papillomatosis, juvenile and adult, observing if there are epidemiological or clinical differences between them. study design: historical cohort. material and method: we studied the patients followed in the ent department of hc-fmusp with diagnosis of laryngeal papilomatose between 1990 and 1999. fifty-one patients were identified, but seven did not confirm the diagnosis. thus, 44 individuals were the base of this study, being 47,72% of juvenile form and 52,27% of adult form. results: there was no prevalence between gender (p=.98). the mean age at the beginning of the symptoms was of 5,3 years in juvenile form and 42,6 years in adult form. dyspnea was more prevalent in juvenile form (p=.03). general recurrence was 66%, being of 76,2% in juvenile form and 56,5% in adult form (p=.17). the incidence of early recurrence (<3 months) was higher in juvenile form (p<.001). we observed 13% of malign transformation in adult form of the disease. conclusions: in juvenile form, we have identified early recurrences associated with dyspnea, requiring multiple interventions. in adult form, we have also observed elevated recurrences, with high index of malign transformation. treatments that increase the time between recurrences are necessary in two forms of papillomatosis.
Papilomatose laríngea recorrente: experiência de 10 anos
Ximenes Filho Joo Arago,Simoceli Lucinda,Imamura Rui,Tsuji Domingos Hiroshi
Revista Brasileira de Otorrinolaringologia , 2003,
Abstract: INTRODU O: Os papilomas de vias respiratórias s o tumores benignos, de caráter recorrente e progressivo, induzidos por vírus. Sua etiologia está relacionada com infec es por papilloma virus humano, sendo descritas duas formas clínicas: juvenil e adulta. OBJETIVO: Comparar as duas formas de apresenta o, juvenil e adulta, observando se há diferen as epidemiológicas ou clínicas entre elas. DESENHO DO ESTUDO: Coorte histórica. MATERIAL E MéTODO: Realizou-se estudo dos pacientes atendidos na Clínica Otorrinolaringológica do HC-FMUSP com diagnóstico de papilomatose laríngea entre 1990 e 1999. Cinqüenta e um pacientes foram identificados, mas sete n o confirmaram o diagnóstico. Assim, 44 indivíduos foram a base desta revis o, sendo 47,72% da forma juvenil e 52,27% da forma adulta. RESULTADOS: N o houve predomínio entre os sexos (p=0,98). A idade média de início dos sintomas foi de 5,3 anos na forma juvenil e 42,6 anos na forma adulta. A dispnéia foi mais prevalente na forma juvenil (p=0,03). A taxa de recidiva geral foi de 66%, sendo de 76,2% na forma juvenil e 56,5% na forma adulta (p=0,17). A incidência de recidiva precoce (<3 meses) foi maior na forma juvenil (p<0,001). Observamos 13% de transforma o maligna na forma adulta da doen a. CONCLUS ES: Na forma juvenil, ocorreram recidivas precoces associadas a quadros de dispnéia, necessitando de múltiplas interven es. Na forma adulta, também observamos alta taxa de recidivas, com índice elevado de transforma o maligna. Tratamentos que aumentem o tempo entre as recidivas se fazem necessários nas duas formas de apresenta o da doen a.
Page 1 /121934
Display every page Item


Home
Copyright © 2008-2017 Open Access Library. All rights reserved.