oalib

Publish in OALib Journal

ISSN: 2333-9721

APC: Only $99

Submit

Any time

2020 ( 2 )

2019 ( 11 )

2018 ( 26 )

2017 ( 17 )

Custom range...

Search Results: 1 - 10 of 9997 matches for " Frank;Rutz "
All listed articles are free for downloading (OA Articles)
Page 1 /9997
Display every page Item
Desempenho de frangos de corte alimentados com diferentes níveis de farelo de canola
Franzoi, Elena Elisabete;Siewerdt, Frank;Rutz, Fernando;Brum, Paulo Ant?nio Rabenschlag de;Gomes, Paulo Cezar;
Ciência Rural , 1998, DOI: 10.1590/S0103-84781998000400024
Abstract: the objective of this experiment was to determine the best level of substitution of soybean meal by canola meal in rations for broilers. five levels of substitution of soybean meal by canola meal were compared: 0, 10, 20, 30, and 40%. twelve hundred one-day ross chicks were used, grouped by sex and weight. animals were fed rations with 22% of crude protein and 3000kcal me/kg from 0 to 21 days, 20% of crude protein and 3100kcal me/kg from 22 to 35 days, and 18% of crude protein and 3150 kcal me/kg from 36 to 42 days. feed consumption was reduced from 0 to 21 days and from 36 to 42 days when higher amounts of canola meal were used in the diets. a reduction in weight gain of the broilers was observed only from 0 to 21 days. feed conversion was improved from 0 to 21 days and from 22 to 35 days. canola meal can participate in diets for broilers from 22 to 42 days of age in quantities up to 40% of the amount of the soybean meal used.
Composi??o de carca?a de frangos de corte alimentados com farelo de canola
Franzoi, Elena Elisabete;Siewerdt, Frank;Rutz, Fernando;Brum, Paulo Ant?nio Rabenschlag de;Gomes, Paulo Cezar;
Ciência Rural , 2000, DOI: 10.1590/S0103-84782000000200023
Abstract: an evaluation of the effects of using canola meal on the carcass composition of broilers was performed. soybean meal was partially substituted (0, 10, 20, 30, or 40%) by canola meal in the diets. fourty experimental units of 30 birds each were formed according to the bird=s initial weight and sex. the diets were formulated to contain 22, 20, or 18% of crude protein and 3000, 3100 or 3150kcal of metabolizable energy per kg of diet, and broilers were fed respectively in the periods between 0 and 21, 22 and 35, and 36 and 42 days. on day 42, a bird from each experimental unit was killed and its carcass composition was determined. carcass protein increased and carcass fat decreased linearly with the amount of canola meal used in the diets. the percentage of carcass fat remained unchanged with the inclusion of canola meal in the diets. neither carcass yield nor the levels of crude energy and ashes in the carcasses were changed. the use of canola meal in the diets can be recommended because the quality of the carcasses was improved. quality improvement was achieved without losses in carcass weight or yield.
Nationallizenzen aus Sicht und im F rderspektrum der Deutschen Forschungsgemeinschaft (DFG): Grundlagen und Einbindung in die F rderstrukturen / National licences from the point of view and in the funding spectrum of the Deutsche Forschungsgemeinschaft (DFG): basic principles and embedding into the structures of funding
Rutz, Reinhard
GMS Medizin-Bibliothek-Information , 2007,
Abstract: The Deutsche Forschungsgemeinschaft (DFG) ist the biggest third-party research funding organisation in Germany. In 2007 it supplied 15 Million Euro for national licences for archived digital content and for the first time 18.5 Million Euro for national licences for current subscriptions of e-journals in oder to support research information infrastructure. The paper describes DFG's aims and the hithero installation process of national licences funding program since 2004. Furthermore a basic outline of the focus initiative "Digital Information 2008-2012" will be given. The initiative is part of DFG's system of nationwide literature supply for research purposes which includes support for the important area of special subject collections. This system is funded by the DFG since decades.
Ego-Dokument oder Ich-Konstruktion? Selbstzeugnisse als Quellen zur Erforschung des frühneuzeitlichen Menschen
Rutz, Andreas
Zeitenblicke , 2002,
Abstract: Der Beitrag führt in die methodologische Diskussion um Ego-Dokumente und Selbstzeugnisse ein. Diese zielt insbesondere im deutschsprachigen Raum auf eine ad quate Begrifflichkeit zur Charakterisierung beziehungsweise quellentypologischen Einordnung der betreffenden Texte. Trotz aller formalen Unterschiede, die sich aus einer solchen Typologisierung ergeben, werden Ego-Dokumente/Selbstzeugnisse in ihrer Gesamtheit als Quellen verstanden, die einen Zugang zum historischen Individuum und seinen Lebens u erungen erm glichen. Aber welche Art von 'Ich' begegnet uns in einem Tagebuch, einer Autobiographie, einem Brief oder einem Verh rprotokoll? Wie jeder historiographische Text ist eine u erung zur eigenen Person stets eine narrative Sinnkonstruktion, die das 'Ich' eines Menschen nicht unmittelbar oder unverf lscht zeigt. Vielmehr konstruiert sich das historische Subjekt im Text jeweils neu und begegnet letztlich immer nur als Bild seiner selbst. Diese Ich-Konstruktion spiegelt dennoch die historische Mentalit t des jeweiligen Verfassers wider und erm glicht im besten Fall Einblicke in seine individuelle Gedanken- und Gefühlswelt.
Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle
Martin Hennenberg, Frank Strittmatter, Christer Beckmann, Beata Rutz, Claudius Füllhase, Raphaela Waidelich, Francesco Montorsi, Petter Hedlund, Karl-Erik Andersson, Christian G. Stief, Christian Gratzke
PLOS ONE , 2012, DOI: 10.1371/journal.pone.0050904
Abstract: Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 μM) or NA (30 μM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 μM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.
Towards in vivo application of RNA interference – new toys, old problems
Sascha Rutz, Alexander Scheffold
Arthritis Research & Therapy , 2004, DOI: 10.1186/ar1168
Abstract: In the postgenomic era it has become a major challenge to develop efficient reverse genetic approaches (i.e. from genotype to phenotype) to evaluate the function of a vast number of newly identified genes. Furthermore, specific silencing of disease-relevant genes (e.g. from tumours, pathogens, or inflammatory mediators) is an interesting therapeutic strategy. In this respect RNA interference (RNAi) technology, which allows targeted 'knockdown' of individual genes by so-called small interfering RNAs (siRNAs) [1], has already opened up new avenues for functional analyses in vitro, and holds great promise for analytical as well as therapeutic applications in vivo.Although other gene silencing approaches, using antisense oligonucleotides, ribozymes, or DNAzymes, have been introduced over the past 25 years, their application has been restricted to certain areas. Only one antisense-based pharmacological agent has thus far been approved. In contrast to those technologies, RNAi represents a physiological process that occurs naturally in many eukaryotes, where it has evolved probably as a mechanism to defend against invading nucleic acids such as viruses and transposons [2,3], and therefore it is easily applicable to a large variety of organisms, cell types and genes. The technology has remarkable target specificity and requires only low amounts of siRNA effector molecules per cell, which can even be expressed directly in situ, allowing long-term silencing of target genes. This makes RNAi an interesting tool for the analysis of loss-of-function phenotypes in vivo and it may also lead to the development of new gene therapeutic approaches.As for all gene silencing approaches, the critical step toward application of RNAi in mammals is the delivery of effector molecules into the target cell. What has been accomplished rather easily in cell lines represents a much greater challenge in hard-to-transfect primary mammalian cells, which are of course the ultimate targets.This review
Influence of the Degree of Maturation on the Bioactive Compounds in Blackberry (Rubus spp.) cv. Tupy  [PDF]
Josiane K. Rutz, Glenise B. Voss, Rui Carlos Zambiazi
Food and Nutrition Sciences (FNS) , 2012, DOI: 10.4236/fns.2012.310189
Abstract: Fruit consumption is primarily due to the increasing awareness of consumers on the health benefits of a healthy diet. Thus some small fruits stand out because they have bioactive compounds that may have health benefits. Among these fruits is the blackberry, which contains different levels of bioactive compounds depending on the maturation stage. Therefore, the aim of this study was to evaluate the phytochemical and physicochemical compositions of blackberries (cv. Tupy) at three maturation stages. It was observed that during maturation, there was a decrease in acidity, carotenoids and tocopherols and an increase in the total soluble solids, pH, anthocyanins, antioxidant activity and total amount of phenolic compounds. Epicatequin was the major phenolic compound found in blackberries.
Patient-Provider-Relationship in the Hospital Care of the Elderly—A Qualitative, Multi-Perspective Study  [PDF]
Maria Rutz, Ulrike Junius-Walker, Marie-Luise Dierks
Open Journal of Nursing (OJN) , 2017, DOI: 10.4236/ojn.2017.77063
Abstract: For many years, there has been a growing demand for patient-centered care in inpatient settings, but a lack of clear consensus on how to exactly implement such programs. The main aim of this study was to analyze patient-centered care in the acute-care setting in a multidimensional manner from the perspectives of elderly patients, their relatives, and an independent observer. A multi-method design was used to capture the three perspectives. Passive observations and post-situational interviews with patients were integrated with semi-structured interviews with patients and their relatives. 18 elderly patients and their relatives (n = 8) were recruited on wards for internal medicine of six hospitals. The data show significant deficits in patient-centered care in the acute-care setting. Although individual patients have different needs, certain categories of deficits emerge as universally relevant, one being the patient-provider-relationship. Patients express a desire for more frequent contact with the hospital staff. Access to doctors and nurses is particularly limited at night and on weekends. The patients are aware of these limitations and often do not draw attention to their own needs to reduce the workload on the staff. The wishes and needs of patients are not always adequately addressed. However, patients, relatives and the independent observer take positive notice of some employees because of their patient-centered attitude. The results show that there is still a need for improvement of patient-centered care. Participants from all three perspectives described differences between employees within the same institutional setting. This finding suggests that patient-centered care strongly depends on the personality of the individual caregiver.
Zu dieser Ausgabe
Rutz, Andreas,Elit, Stefan,Kraft, Stephan
Zeitenblicke , 2002,
Abstract:
Integration with Writing Programs: A Strategy for Quantitative Reasoning Program Development
Nathan D. Grawe,Carol A. Rutz
Numeracy , 2009,
Abstract: As an inherently interdisciplinary endeavor, quantitative reasoning (QR) risks falling through the cracks between the traditional “silos” of higher education. This article describes one strategy for developing a truly cross-campus QR initiative: leverage the existing structures of campus writing programs by placing QR in the context of argument. We first describe the integration of Carleton College’s Quantitative Inquiry, Reasoning, and Knowledge initiative with the Writing Program. Based on our experience, we argue that such an approach leads to four benefits: it reflects important aspects of QR often overlooked by other approaches; it defuses the commonly raised objection that QR is merely remedial math; it sidesteps challenges of institutional culture (idiosyncratic campus history, ownership, and inertia); and it improves writing instruction. We then explore the implications of our approach for QR graduation standards. Our experience suggests that once we engaged faculty from across the curriculum in our work, it would have been difficult to adopt a narrowly defined requirement of skills-based courses. The article concludes by providing resources for those who would like to implement this approach at the course and institutional level.
Page 1 /9997
Display every page Item


Home
Copyright © 2008-2017 Open Access Library. All rights reserved.