oalib

Publish in OALib Journal

ISSN: 2333-9721

APC: Only $99

Submit

Any time

2019 ( 22 )

2018 ( 35 )

2017 ( 24 )

2016 ( 25 )

Custom range...

Search Results: 1 - 10 of 1801 matches for " Afzal Hossain "
All listed articles are free for downloading (OA Articles)
Page 1 /1801
Display every page Item
Design and Development of Weather Monitoring and Controlling System for a Smart Agro (Farm)  [PDF]
Sumya Tabassum, Afzal Hossain
Intelligent Control and Automation (ICA) , 2018, DOI: 10.4236/ica.2018.93005
Abstract: Weather plays an important role in our farming system. In greenhouse or internal farming system, weather monitoring is important. For better production and maintenance, it is important to monitor. This project is developed for forecasting weather parameters like humidity, temperature, soil moisture, and raid detection. Humidity and temperature are monitored for internal temperature. The soil is the most important part of a greenhouse. In this project, soil moisture level is monitored and controlled for maintaining soil moisture level. Rain detection is used in outside of the farm. It detects rainwater and sends a message to the server. It is monitored by using a local server. In remote routing area, it also can be monitored and controlled without physical existence. Also, it is a low-cost weather monitoring system for the agro farm. The Raspberry Pi is a low cost, credit-card sized computer that plugs into a computer monitor or TV, and uses a standard keyboard and mouse. The monitoring system could be designed by using the sensor. It is useful for forecasting and data analysis process. In this project weather forecasting system is designed by using a sensor. In this project, Raspberry Pi work like a remote monitoring and controlling system for the agro farm.
Nutritional Status of Red Amaranth as Influenced by Selected Pesticides
Md. Shariful Islam,Jahan Ara Khatoon,M. Alamgir,Md. Afzal Hossain
Pakistan Journal of Biological Sciences , 2003,
Abstract: A study was undertaken in the Department of Biochemistry, Bangladesh Agricultural University, Mymensingh to evaluate the nutritional status of red amaranth as influenced by three selected pesticides at various dose levels. The results revealed that the level of moisture content ranged from 86.50 to 87.62% in different treatment groups. The highest amount was in T4 where chlorpyrifos @ 0.66 a.i./ha was sprayed at 21 days after emergence and the lowest (86.5%) was in control group (T13) where no pesticide was applied. The dry matter percent was highest in control (13.50%) and slightly lower in treatment groups indicating no significant variation among them. The protein percent was from 5.02 to 5.24 in different treatment groups expressing little higher than the control plants (4.82%). Fat percentage ranged from 0.10 to 0.12 in treatment groups, which were very close to control value. Total sugar was highest (2.10) in T7, T9 and T11 and lowest in T6 (carbofuran). Reducing sugar was 1.15% in T7 (cypermethrin and chlorpyrifos) and 0.98 in T6, while non-reducing sugar seemed to be little higher (1.11%) in treatment groups compared to the control (0.88%). As a whole pesticide studied had very insignificant effect on protein, fat, ash, dry matter and moisture content of red amaranth. The carotene content was highest (10.24 mg 100 gG1) immediately after harvest in T1 and lowest in T8. But the level of carotene decreased to 9.08 mg 100 gG1 in T8, which was statistically insignificant. As far as vitamin C is concerned, the level was reasonably good in all the treatments as well as control plants immediately after harvest (38.52 mg - 40.41 mg). The level of vitamin C decreased in all the treatment and control plants after 20 minutes cooking (26.21-28.25 mg).
Studies on the reconstitution properties of stored dried spotted spanish mackerel (Scomberomorus guttatus)
Shamima Prodhan 1* , M Kamrujjaman 1 , M Afzal Hossain 2 , M Samsul Islam2
International Journal of Biosciences , 2011,
Abstract: A study was carried out to compare and evaluate the percentage of reconstitution media (tap water, hot water, 5% NaCl and 5% Ca(OH)2) uptake of stored dried control, irradiated (1 kGy) and heat treated (50 °C) spotted spanish mackerel Scomberomorus guttatus at room temperature for 1, 4 and 24 dipping hours upto 180 days of storage period after each 30 days of intervals. Maximum media uptake found in 5% Ca(OH)2followed by 5% NaCl, hot water and tap water in all samples. The highest (121.81%) and lowest (4.07%) percentage of media uptake observed in Ca(OH)2 and tap water respectively from the irradiated fish sample. This study also reveals that percentage of media uptake depends on reconstitution medias and dipping hours significantly but not with the various samples.
Monitoring the Residue Level of Three Selected Pesticides in Red Amaranth
Jahan Ara Khatoon,Md. Shariful Islam,Nur Mohammad Talukder,Md. Afzal Hossain
Journal of Biological Sciences , 2004,
Abstract: A study was undertaken in the Department of Biochemistry, Bangladesh Agricultural University, Mymensingh to monitor the level of three selected pesticides at various dose levels. In this case edible part of red amaranth was extracted and analyzed for applied pesticide residues. It was found that after one day 0.0065 μg of cypermethrin retained per g of plant sample, which was 0.23% of the applied dose. While on the 3rd day of spray the level of residue was found to decrease (0.0024 μg g1-1) which accounted for 0.085% of the applied dose. In case of higher dose applied, the residue level of chlorpyrifos was 0.0173 μg g-1 whereas the level increased to 0.0237 μg g1-1 on 3rd day of application. It seemed that the uptake of chlorpyrifos by red amaranth from soil and its accumulation therein was higher on 3rd day of application. The residue level of carbofuran was very low both at 1st and 3rd day of application. However, an increasing trend of incorporation was observed on 3rd day of application. It is remarkable to note that when higher level of chlorpyrifos and carbofuran were jointly applied, the amount of chlorpyrifos as residue increased but the level of carbofuran decreased. Finally carbofuran could not be traced after 72 h of joint application. So study indicated that chlorpyrifos might exert antagonistic effect on the uptake/accumulation of carbofuran in plant system.
Comparative Study of Raw and Boiled Silver Pomfret Fish from Coastal Area and Retail Market in Relation to Trace Metals and Proximate Composition
Roksana Huque,M. Kamruzzaman Munshi,Afifa Khatun,Mahfuza Islam,Afzal Hossain,Arzina Hossain,Shirin Akter,Jamiul Kabir,Yeasmin Nahar Jolly,Ashraful Islam
International Journal of Food Science , 2014, DOI: 10.1155/2014/826139
Abstract: Trace metals concentration and proximate composition of raw and boiled silver pomfret (Pampus argenteus) from coastal area and retail market were determined to gain the knowledge of the risk and benefits associated with indiscriminate consumption of marine fishes. The effects of cooking (boiling) on trace metal and proximate composition of silver pomfret fish were also investigated. Trace element results were determined by the Energy Dispersive X-ray Fluorescence (EDXRF) Spectrometer wherein fish samples from both areas exceeded the standard limits set by FAO/WHO for manganese, lead, cadmiumm and chromium and boiling has no significant effects on these three metal concentrations. Long-term intake of these contaminated fish samples can pose a health risk to humans who consume them. 1. Introduction Fish is a healthy food for most of the world’s population particularly developing countries in contrast to meat, poultry, and eggs. Fish provides comparatively cheap and readily available protein sources (about 15 to 20 percent) in addition to long chains of n-3 fatty acids, amino acids, vitamins, and minerals which contributes to healthier nutritional options for a balance dietary intake [1, 2]. Among the all fishes, marine fish are very rich sources of protein and various mineral components. The total content of minerals in raw flesh of marine fish is in the range of 0.6–1.5% of wet weight [3]. Trace metals are present in water from natural sources such as the rocks of the sea bed and also accumulated as a result of human activities such as emissions from industrial processes. These elements are taken up by marine fishes which are higher up the food chain. As a result, the concentrations of many elements including mercury, arsenic, lead, and cadmium in fish can be relatively high compared to other foods. Many of these metals such as iron, copper, cobalt, manganese, molybdenum, nickel, and zinc are essential trace elements and play important roles in biological systems. Meanwhile, mercury, lead, and cadmium are toxic, even in trace amounts [4]. Moreover, elevated concentration of manganese and nickel has been found to be toxic to aquatic organism [5, 6]. To monitor trace metals concentrations in the coastal environment, marine fishes have been widely used as bioindicators due to their wide range of distribution. Several studies have been carried out on metal pollution in different species of edible fish. Predominantly, fish toxicological and environmental studies have prompted interest in the determination of toxic elements in seafood [7–10]. According to the
An Econometric Analysis for CO2 Emissions, Energy Consumption, Economic Growth, Foreign Trade and Urbanization of Japan  [PDF]
Sharif Hossain
Low Carbon Economy (LCE) , 2012, DOI: 10.4236/lce.2012.323013
Abstract: This paper examines the dynamic causal relationship between carbon dioxide emissions, energy consumption, economic growth, foreign trade and urbanization using time series data for the period of 1960-2009. Short-run unidirectional causalities are found from energy consumption and trade openness to carbon dioxide emissions, from trade openness to energy consumption, from carbon dioxide emissions to economic growth, and from economic growth to trade openness. The test results also support the evidence of existence of long-run relationship among the variables in the form of Equation (1) which also conform the results of bounds and Johansen conintegration tests. It is found that over time higher energy consumption in Japan gives rise to more carbon dioxide emissions as a result the environment will be polluted more. But in respect of economic growth, trade openness and urbanization the environmental quality is found to be normal good in the long-run.
Application of Resource Efficient and Cleaner Production (RECP) in the Energy Intensive Industry to Promote Low Carbon Industrial Development in Bangladesh  [PDF]
Tahazzud Hossain
Low Carbon Economy (LCE) , 2015, DOI: 10.4236/lce.2015.63009
Abstract: The consumption of natural resources (e.g. raw material, water & energy) in the industries is bringing welfare to the society but per unit of product from the industry is linked with the generation of environmental pollutants and emissions. Resource constraints and climate crisis have come into focus globally; particularly it has become one of the major concerns in the Asia Pacific region. At present, the countries in the Asia Pacific use resources three times greater than the rest of the world to generate one unit of GDP. These countries are more vulnerable to the impacts of resource constraints and climate change. Resource Efficient and Cleaner Production (RECP) has come as a preventive environmental measure to facilitate pollution prevention and reduce carbon intensity per unit of products along with financial profit of the industry. Bangladesh has been considered as one of the transition economies in the South Asia. Industrial sector supports second largest share to the GDP of Bangladesh. The industrial productivity in the country is solely dependent on the locally available natural gas and imported raw materials. Energy Efficiency (EE) and Cleaner Production (CP) measures in the industry can facilitate the promotion of low carbon industrial development through pollution prevention and energy conservation. The main objective of this research is to identify the policy instruments for the promotion of low carbon industrial development in Bangladesh within RECP framework. In this research, ceramics sector has been taken as a research unit. Based on the research objective, three research strategies have been followed which are: 1) review of the existing Environmental Policy, Industrial Policy and Energy Policy of Bangladesh, 2) review of the relevant measures adopted in the regional countries, and 3) case study in a ceramic industry. Stakeholder consultation has been conducted to identify appropriate policy instruments based on multi-criteria evaluation. Through this research, eleven policy instruments have been identified in connection with the promotion of RECP measures in the country with the target of developing low carbon industrial operation. Among the eleven policy instruments seven policy instruments have been identified as prioritized policy instruments based on multi-criteria evaluation through stakeholder consultation. Apart from the prioritized policy instruments the Government of Bangladesh (GoB) has to make realistic sector wise policies and specific policy targets to be achieved within timeline. The GoB has to increase
RNAi dependent epigenetic marks on a geminivirus promoter
Afzal Dogar
Virology Journal , 2006, DOI: 10.1186/1743-422x-3-5
Abstract: In plants RNA interference or post transcriptional gene silencing (PTGS) acts as a natural anti-viral defense system for neutralizing pathogenic nucleic acids either through a change in RNA stability in the cytoplasm or through mechanisms that use the RNA itself to induce methylation and silencing of homologous nuclear genes [1]. In addition there are more than one Dicer and Argonaute proteins in plants e.g. Arabidopsis genome encodes four Dicers [2] and ten Argonate orthologs [3]. Geminiviruses are single-stranded circular DNA viruses that cause economically significant diseases in a wide range of crop plants worldwide [4]. They replicate in the plant cell nuclei through transcription and replication competent double stranded DNA intermediate, which is packed into nucleosomes from host cells [5]. In plants, some geminivirus-host interactions naturally lead to host recovery e.g. natural recovery response induced by ACMV-infected N. benthamiana and cassava involves siRNAs originating from geminivirus genome [6]. However the affect of siRNAs at the virus genome remained to be seen. Here I show multiple siRNAs species in transgenic plants direct the methylation of ACMV DNA A as well as the methylation at lysine-9 residues of histone H3 wrapping the promoter region in the virus genome.A 360 nucleotides fragment corresponding to the intergenic region of ACMV DNA A (GenBank: NC_001467) was cloned in sense and anti-sense orientation interrupted with a synthetic plant intron. The left arm KpnI-ClaI and right arm XhoI-BamI fragments were PCR amplifed and cloned into dsproA VMYMV- int vector [7]. The EcoRI-XbaI fragment of this vector was cloned into pCambia 1300. The following primers used for amplification the left arm (KpnI F: GGTACCAATCTCAACTAGAGACACTCTTGA) and (ClaI R: ATCGATGCACAAATATTTAATTGCCAG), and the right arm (XhoI F: CTCGACGCAGTTTATAAATTAACGGGTC) and (BamHI R: GGATCCAATGAGTTGATCTCTGTGAGAACT). The resulting binary construct was introduced into Agrobacterium tumefa
Relationship between Providing Persian Equivalents of English Adjectives and Iranian EFL Learners' Active Vocabulary
Shadi Afzal
International Journal of English Linguistics , 2012, DOI: 10.5539/ijel.v2n1p231
Abstract: This study attempted to find the relationship between providing Persian equivalents of English adjectives and Iranian EFL learners' active vocabulary. To this end, 100 students studying English as a foreign language at a Language Institute in Shiraz were asked to participate in this study. Participants were divided into experimental and control groups with 50 participants in each. The sample was homogenous with regard to their English level. To investigate the possible effects of providing Persian equivalents of English adjectives on Iranian EFL learners' active vocabulary, an independent Sample t-test was run on the vocabulary scores of 100 students. After analyzing the data it was found out the performances of all the participants in the “Experimental” group were better than those in the “Control” group.
Re-designing Smallholder Dairy Production in Pakistan
M. Afzal
Pakistan Veterinary Journal , 2010,
Abstract: No Abstract
Page 1 /1801
Display every page Item


Home
Copyright © 2008-2017 Open Access Library. All rights reserved.