oalib
Search Results: 1 - 10 of 100 matches for " "
All listed articles are free for downloading (OA Articles)
Page 1 /100
Display every page Item
Ultrastructural and quantitative studies of hemocytes in the sugarcane borer, Diatraea saccharalis (Lepidoptera: Pyralidae)
Falleiros, ?ngela Maria Ferreira;Bombonato, Maria Terezinha Siqueira;Gregório, Elisa Aparecida;
Brazilian Archives of Biology and Technology , 2003, DOI: 10.1590/S1516-89132003000200021
Abstract: six circulating hemocytes cell types from diatraea saccharalis (fabricius) (lepidoptera: pyralidae) larvae were identified by transmission and scanning electron microscope: prohemocytes (pr), plasmatocytes (pl) granulocytes (gr), spherulocytes (sp), oenocytoids (oe) and vermicytes (ve). the pr was the smallest cell type with a large nucleus, a cytoplasm with few organelles and a homogenous smooth surface. the pl was polymorphic and abundant, with a cytoplasm rich in organelles and a cellular surface with several cytoplasmic projections. the gr was abundant, showing two types of membrane-bounded granules (dense and structutered), glycogen, lipid droplets and a surface with philopodial projections. the sp was a large cell, with a cytoplasm full of intracytoplasmic spherules. the oe was the largest hemocyte type with a large and homogeneous cytoplasm and scarce organelles. the ve was discoid in shape and showed electron-dense granules.
Ultrastructural and quantitative studies of hemocytes in the sugarcane borer, Diatraea saccharalis (Lepidoptera: Pyralidae)  [cached]
Falleiros ?ngela Maria Ferreira,Bombonato Maria Terezinha Siqueira,Gregório Elisa Aparecida
Brazilian Archives of Biology and Technology , 2003,
Abstract: Six circulating hemocytes cell types from Diatraea saccharalis (Fabricius) (Lepidoptera: Pyralidae) larvae were identified by transmission and scanning electron microscope: prohemocytes (PR), plasmatocytes (PL) granulocytes (GR), spherulocytes (SP), oenocytoids (OE) and vermicytes (VE). The PR was the smallest cell type with a large nucleus, a cytoplasm with few organelles and a homogenous smooth surface. The PL was polymorphic and abundant, with a cytoplasm rich in organelles and a cellular surface with several cytoplasmic projections. The GR was abundant, showing two types of membrane-bounded granules (dense and structutered), glycogen, lipid droplets and a surface with philopodial projections. The SP was a large cell, with a cytoplasm full of intracytoplasmic spherules. The OE was the largest hemocyte type with a large and homogeneous cytoplasm and scarce organelles. The VE was discoid in shape and showed electron-dense granules.
Esterase-3 polymorphism in the sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae)
Ruvolo-Takasusuki, Maria Claudia C.;Machado, Maria de Fátima P.S.;Conte, Hélio;
Genetics and Molecular Biology , 2002, DOI: 10.1590/S1415-47572002000100012
Abstract: the migration rate of esterases and their substrate specificity for 4-methylumbelliferyl esters (acetate, propionate, and butyrate) and a- and b-naphthyl esters were analyzed in diatraea saccharalis by starch gel electrophoresis. substrate preference of esterases was observed with est-2 and est-8 isozymes showing substrate specificity for 4-methylumbelliferyl esters and est-4 isozyme showing specificity for 4-methylumbelliferyl butyrate and a-naphthyl butyrate. allele variation was detected at the est-3 locus. two alleles, est-3f and est-3s, were identified in pupae with fluorogenic and ester-naphthyl substrates. chi-square analysis showed no differences between the observed genotypic frequencies and those expected on the basis of hardy-weinberg frequencies for the est-3 locus (c2 = 2.4; p < 0.01). the negative value for the wright's fixation index (f = -0.2096) calculated for the d. saccharalis population maintained under laboratory conditions indicates an excess of heterozygotes, however, the observed hardy-weinberg equilibrium indicates that in the laboratory the population of d. saccharalis behaved as if the moth were randomly mating in nature. the high level of heterozygosity at the est-3 locus indicates also that this esterase may be a good genetic marker for studies of natural d. saccharalis populations.
Esterase-3 polymorphism in the sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae)  [cached]
Ruvolo-Takasusuki Maria Claudia C.,Machado Maria de Fátima P.S.,Conte Hélio
Genetics and Molecular Biology , 2002,
Abstract: The migration rate of esterases and their substrate specificity for 4-methylumbelliferyl esters (acetate, propionate, and butyrate) and alpha- and beta-naphthyl esters were analyzed in Diatraea saccharalis by starch gel electrophoresis. Substrate preference of esterases was observed with Est-2 and Est-8 isozymes showing substrate specificity for 4-methylumbelliferyl esters and Est-4 isozyme showing specificity for 4-methylumbelliferyl butyrate and alpha-naphthyl butyrate. Allele variation was detected at the Est-3 locus. Two alleles, Est-3F and Est-3S, were identified in pupae with fluorogenic and ester-naphthyl substrates. Chi-square analysis showed no differences between the observed genotypic frequencies and those expected on the basis of Hardy-Weinberg frequencies for the Est-3 locus (chi2 = 2.4; p < 0.01). The negative value for the Wright's fixation index (F = -0.2096) calculated for the D. saccharalis population maintained under laboratory conditions indicates an excess of heterozygotes, however, the observed Hardy-Weinberg equilibrium indicates that in the laboratory the population of D. saccharalis behaved as if the moth were randomly mating in nature. The high level of heterozygosity at the Est-3 locus indicates also that this esterase may be a good genetic marker for studies of natural D. saccharalis populations.
Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers
Destéfano, Ricardo Henri Rodrigues;Destéfano, Suzete A. Lanza;Messias, Claudio Luiz;
Genetics and Molecular Biology , 2004, DOI: 10.1590/S1415-47572004000200020
Abstract: in order to construct specific primers for the detection and identification of the entomopathogenic fungus metarhizium within infected sugarcane borer (diatraea saccharalis) larvae we analyzed the its1 -5.8s- its2 rdna regions of strains and varieties of m. anisopliae, m. album and m. flavoviride. the pcr amplification of these regions yielded a unique fragment of approximately 540 bp for m. anisopliae variety anisopliae strains e9, b/vi and c (isolated in brazil), 600 pb for m. a. anisopliae strain 14 (isolated in australia), 650 bp for the m. album and 600 bp for m. flavoviride strains. the pcr products were digested with different restriction endonucleases (afa i, alu i, dde i, hae iii, hpa ii and sau 3a) and the pcr-rflp profiles showed clear differences between the species. sequencing of the its-5.8s rdna regions allowed us to design one specific primer (itsmet: 5' tctgaattttttataagtat 3') for the brazilian m. a. anisopliae strains (e9, b/vi and c) and another specific primer (itsmet14: 5' gaaaccgggac taggcgc 3') for the australian strain (strain 14). amplification was not observed with m. album, m flavoviride and beauveria bassiana strains. dna extracted from larvae infected with the brazilian or australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. the correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of m. anisopliae.
PERDAS DE PRODU O PELA BROCA-DO-COLMO (Diatraea saccharalis Fabr. 1794) (LEPIDOPTERA: PYRALIDAE) EM GENóTIPOS DE ARROZ DE TERRAS ALTAS YIELD LOSSES BY STEM BORER (Diatraea saccharalis Fab. 1794) (LEPIDOPTERA: PYRALIDAE) IN UPLAND RICE GENOTYPES
Evane Ferreira,José Alexandre Freitas Barrigossi,Alberto Baêta dos Santos
Pesquisa Agropecuária Tropical , 2007, DOI: 10.5216/pat.v34i2.2332
Abstract: Estudou-se o efeito da infesta o natural de Diatraea saccharalis na produ o de espiguetas de 24 genótipos de arroz de terras altas, em um experimento de campo. O efeito de colmos infestados pelas lagartas D. saccharalis na massa de espiguetas de amostras e da área útil das parcelas foi estimado por um índice de perda e por análise de regress o. O índice utilizado quantifica a perda de massa de espiguetas por colmo brocado em rela o à massa de espiguetas de colmo n o brocado. As estimativas obtidas pelos dois métodos foram discrepantes. Menos de 10% dos genótipos manifestaram rela o linear ou quadrática entre a infesta o e o dano da broca-do-colmo. Perdas calculadas por esse índice mostraram-se mais adequadas às condi es do experimento. A infesta o de D. saccharalis aparentemente n o afetou a massa de espiguetas em cinco dos genótipos, causou pequenas redu es em dois genótipos e, na maioria deles (17 genótipos), causou redu es de importancia econ mica. O genótipo CNAs9023 teve a menor infesta o e a maior massa de espiguetas, demonstrando maior resistência em compara o à linhagem CNAs9028, que foi o genótipo mais infestado e com menor produ o. PALAVRAS-CHAVE: Arroz de terras altas; broca do colmo; amostragem; avalia o de genótipos. The impact of the Diatraea saccharalis natural infestation on yield of 24 genotypes of upland rice was studied in an experiment carried out in field conditions. The attack of D. saccharalis on stems and its effect on spikelet weight was determined using a yield loss index and by regression analysis. The index used quantifies the spikelet mass loss per bored stem in relation to spikelet mass no bored stem. The estimates obtained with these two methods were different. Less than 10% of genotypes showed a linear relationship between the infestation and stem borer damage. Estimated yield losses based on the index seemed more appropriate to the conditions of the experiment. Infestations by D. saccharalis did not visibly affect the weight of spikelets of five genotypes, caused a small reduction in two genotypes, and caused economic losses in the most of them (17 genotypes). The CNAs9023 genotype was the least infested and presented the highest weight of spikelets, and showed more resistance than CNAs9028, which was more infested and produced less. KEY-WORDS: Upland rice; stem borer; sampling; genotype evaluation.
Aspectos biológicos e dano de Diatraea saccharalis (fabr., 1794) (Lepidoptera: Pyralidae) em sorgo cultivado sob diferentes doses de nitrogênio e potássio
Bortoli, Sergio Ant?nio de;Dória, Háyda Oliveira Souza;Albergaria, Nuno Miguel Mendes Soares;Botti, Maurício Vladimir;
Ciência e Agrotecnologia , 2005, DOI: 10.1590/S1413-70542005000200001
Abstract: this work was carried out to evaluate the influence of the fertilization of sorghum, sorghum bicolor (l.) moench, on the stem borer diatraea saccharalis (fabr., 1794) (lepidoptera: pyralidae) biology. it was used the variety rubi-asgrow. the treatments were (nk doses): n1 = 0-200 ppm; n2 = 50-200 ppm; n3 = 100-200 ppm; n4 = 200-200 ppm; n5 = 400-200 ppm; k1 = 200-0 ppm; k2 = 200-50 ppm; k3 = 200-100 ppm; k4 = 200-200 ppm and k5 = 200-400 ppm. it was possible to conclude that nitrogen doses from 50 to 200 ppm provide a normal development for d. saccharalis larvae, although the lowest percentage of damage was verified with the lowest dose; while for the potassium, the highest dose favoured the caterpillars development, but less damage was observed on the plants.
Morphometric study of the midgut epithelium in larvae of Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae)
Pinheiro, Daniela O.;Silva, Reinaldo J.;Quagio-Grassiotto, Irani;Gregório, Elisa A.;
Neotropical Entomology , 2003, DOI: 10.1590/S1519-566X2003000300012
Abstract: the sugarcane borer, diatraea saccharalis fabricius, has great economical interest as it affects the culture and industrial use of the sugarcane. however, there are few studies concerning the internal morphology of this insect. this work aims to study morphometrically the midgut and the epithelium along their lenght, trying to characterize different regions. midgut of last instar larvae was divided in three regions: anterior, middle and posterior, and the fragments were processed for light microscopic observation. histological sections were analyzed in a computerized system concerning the length, width and area of the epithelium, their cells, and the midgut lumen. the obtained data were statistically analyzed by the kruskal-wallis test and by multivariate analysis. our results showed that the midgut has two different regions, the anterior and the posterior; the middle region presents values that are coincident with the ones of either the anterior and the posterior portions, suggesting that there is an intermediate region between the other two ones. the epithelial cells (columnar, goblet and regenerative cells), when evaluated by multivariate analysis, do not present significant morphometric differences in the different midgut regions. however, the analysis of variance for separate variables show that the regenerative cells present wide morphometric variability along the midgut.
Presencia natural de hongos hyphomycetes en larvas invernantes de Diatraea saccharalis F. en ca?a de azúcar en Tucumán, Argentina
Yasem de Romero,Marta G.; Salvatore,Analia R.; López,Germán; Willink,Eduardo;
Revista industrial y agr?-cola de Tucum??n , 2008,
Abstract: sugarcane borer diatraea saccharalis (fabricius) (lepidoptera: pyralidae) is the most important pest affecting sugarcane crops in tucumán. optimizing its management entails combining different available resources, even natural ones, accurately. since 2005, a survey of entomopathogenic fungi present in the local sugarcane agroecosystem has been under way. the aim is to detect and identify entomopathogenic fungi which cause natural death in hibernating d. saccharalis larvae affecting sugarcane in tucumán, argentina. by now, beauveria bassiana (bals.) vuill. (57.13%), metarhizium anisopliae (metsch.) sorokin (23.82%), nomuraea rileyi (farlow) samson (9.53%) and isaria sp. persoon: fries (9.53%) have been found naturally in hibernating sugarcane borer larvae in sugarcane crops in the province of tucumán. this finding may be relevant in suggesting that sugarcane borer population might be regulated by hyphomycetes.
Ultrastructure of the Lyonet's glands in larvae of Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae)
Victoriano,Eliane; Gregório,Elisa A.;
Biocell , 2004,
Abstract: the lyonet's gland is found in lepidoptera larvae, close to the excretory duct of the silk gland. the role played by this gland is still uncertain. this work aims to describe the ultrastructure of the lyonet's gland in diatraea saccharalis larvae, offering suggestions regarding its possible function. the insects were reared under laboratory-controlled conditions. the glands were conventionally prepared for transmission (tem) and scanning (sem) electron microscopy. sem showed that lyonet's glands are paired small structures located in the ventral side of the head. they are composed by clustered long cells resembling leaves. under tem observations, each cell is surrounded by a thin basal lamina and contains large stellate nucleus. the cytoplasm presents large and empty canaliculi with small microvilli. the basal plasma membrane forms numerous infoldings where numerous and well-developed mitochondria are concentrated. the cytoplasmic membrane system is poorly developed. our ultrastructural results suggest that the lyonet's gland in d. saccharalis larvae may be involved in the uptake of small molecules from the hemolymph; no morphological evidences of macromolecules synthesis and secretion were noticed. the detection of nerve fibers in the gland suggest a neural control for the glandular cell function.
Page 1 /100
Display every page Item


Home
Copyright © 2008-2017 Open Access Library. All rights reserved.