oalib
Search Results: 1 - 10 of 100 matches for " "
All listed articles are free for downloading (OA Articles)
Page 1 /100
Display every page Item
Efeito da endogamia sobre características morfométricas em cavalosda ra?a Mangalarga Marchador
Gon?alves, R.W.;Costa, M.D.;Rezende, A.S.C.;Rocha Júnior, V.R.;Leite, J.R.A.;
Arquivo Brasileiro de Medicina Veterinária e Zootecnia , 2012, DOI: 10.1590/S0102-09352012000200023
Abstract: the coefficient of inbreeding was estimate and its effect on linear traits of the mangalarga marchador horses reared in a ranch in the north of minas gerais was evaluated. the characteristics studied were morphometric traits such as wither and hip height, length of head, neck, back-loin, hip and body, as well as chest and hip width. the archive had 2186 data on the genealogy of animals from the herd register of the catuni farm. the coefficient of inbreeding (f) was calculated and its effect was evaluated by means of simple linear regression on the linear traits. of all animals, 27.6% showed inbreeding, with an f average of 1.4% in the population. considering only the inbred animals, the average consanguinity reached 5.3% minimum of 0.1 and maximum of 28.1%. negative effects of inbreeding on the morphometric traits were not seen, except for hip width, where for each 10% increase in f there was increase of 0.576cm. possibly due to the low value found, inbreeding did not influence the other evaluated characteristics.
Análise temporal da endogamia e do tamanho efetivo da popula??o de eqüinos da ra?a Mangalarga Marchador
Costa, M.D.;Bergmann, J.A.G.;Resende, A.S.C.;Fonseca, C.G.;
Arquivo Brasileiro de Medicina Veterinária e Zootecnia , 2005, DOI: 10.1590/S0102-09352005000100015
Abstract: data on 286,047 mangalarga marchador horses from the studbook of the associa??o brasileira dos criadores do cavalo mangalarga marchador, born between 1949 and 1999 were used to describe the population genetic structure of the breed. average inbreeding coefficient was 1.3% for all population and 22.6% of all animals were inbred with average inbreeding coefficient of 5.7%, varying from 0.001 to 46.9%. for the actual population, average inbreeding coefficient was 3.8% for offspring and 7.3% for their parents. variation between two-year periods was observed for effective population size which was 9, 174, 24 for animals born in the 1998-1999 period. the ratios between effective population size and observed number of animals were mostly less than .50, varying from .39 in 1980-1981 to .79 in 1954-1955.
Studies of blood groups and protein polymorphisms in the Brazilian horse breeds Mangalarga Marchador and Mangalarga (Equus caballus)
Lippi, Andréia Samaha;Mortari, Norma;
Genetics and Molecular Biology , 2003, DOI: 10.1590/S1415-47572003000400005
Abstract: allelic frequencies at 12 loci (five blood groups: c, d, k, p, and u; and seven protein polymorphisms: al, a1b, es, gc, hb, pgd, and tf), are given for two brazilian horse breeds: mangalarga marchador and mangalarga. the high genetic identity value found (96.0%) is consistent with their common origin, although, at some point of the development of mangalarga marchador, mangalarga separated from the original stock. the expected average heterozygosity was higher in mangalarga marchador. the populations presented genetic differentiation, as shown by the statistically significant value of fst. the nonsignificant fis values showed that there was no appreciable consanguineous mating in any of the two populations. exclusion probability calculated for the 12 loci was 87.0% and 86.5% for mangalarga marchador and mangalarga, respectively. no genetic equilibrium was observed in the a1b, tf, and es loci of mangalarga marchador. the frequencies of blood factors a, q, and t were calculated.
Studies of blood groups and protein polymorphisms in the Brazilian horse breeds Mangalarga Marchador and Mangalarga (Equus caballus)
Lippi Andréia Samaha,Mortari Norma
Genetics and Molecular Biology , 2003,
Abstract: Allelic frequencies at 12 loci (five blood groups: C, D, K, P, and U; and seven protein polymorphisms: Al, A1B, Es, Gc, Hb, PGD, and Tf), are given for two Brazilian horse breeds: Mangalarga Marchador and Mangalarga. The high genetic identity value found (96.0%) is consistent with their common origin, although, at some point of the development of Mangalarga Marchador, Mangalarga separated from the original stock. The expected average heterozygosity was higher in Mangalarga Marchador. The populations presented genetic differentiation, as shown by the statistically significant value of F ST. The nonsignificant F IS values showed that there was no appreciable consanguineous mating in any of the two populations. Exclusion probability calculated for the 12 loci was 87.0% and 86.5% for Mangalarga Marchador and Mangalarga, respectively. No genetic equilibrium was observed in the A1B, Tf, and Es loci of Mangalarga Marchador. The frequencies of blood factors A, Q, and T were calculated.
Efeito da endogamia sobre características produtivas e reprodutivas de bovinos do ecótipo Mantiqueira
Silva Marcos Vinícius Gualberto Barbosa da,Ferreira William José,Cobuci Jaime Araujo,Guaragna Guilherme Paes
Revista Brasileira de Zootecnia , 2001,
Abstract: Foram analisados registros de genealogia de 2070 animais, bem como informa es provenientes das cinco primeiras lacta es de 1406 vacas do ecótipo Mantiqueira, filhas de 113 reprodutores, com o objetivo de avaliar a freqüência de animais endogamicos, a média de endogamia por gera o e o possível reflexo do aumento da endogamia sobre algumas características reprodutivas e produtivas. As características avaliadas foram idade ao primeiro parto (IPP), intervalo de partos (IDP), produ o total de leite (PL) e dura o da lacta o (DL). Foram usados modelos que incluíam, para PL, IDP e DL, os efeitos fixos de ano-esta o de parto; como covariável, a idade da vaca ao parto, em meses, com termos linear e quadrático, além dos efeitos aleatórios de animal, de ambiente permanente e erro. Na análise envolvendo a PL, incluiu-se ainda o efeito fixo da dura o da lacta o. No estudo de IPP, o modelo utilizado considerou como efeito fixo ano-esta o de nascimento e, como aleatórios, animal e erro. As análises foram realizadas utilizando-se a metodologia da máxima verossimilhan a restrita. Para se verificar o comportamento da endogamia ao longo dos anos, os animais foram agrupados em gera es. Verificou-se aumento expressivo do número de animais endogamicos, bem como dos níveis médios do coeficiente de endogamia, que oscilaram entre 0,33 e 7,34%, com crescimento até a última gera o. Observaram-se efeitos linear da endogamia sobre os valores genéticos para PL e IPP e quadrático para IDP e DL. A endogamia influenciou de maneira negativa os valores genéticos para as características estudadas, promovendo redu es para PL e DL e aumentos para IPP e IDP. A falta de um programa de acasalamento eficiente e, principalmente, o fato de o rebanho ser fechado, têm sido fatores determinantes no aumento contínuo do nível de endogamia e do número de animais endogamicos.
Caracteriza??o demográfica da ra?a Mangalarga Marchador
Costa, M.D.;Bergmann, J.A.G.;Resende, A.S.C;Martins, G.A.;Bretas, M.S.;
Arquivo Brasileiro de Medicina Veterinária e Zootecnia , 2004, DOI: 10.1590/S0102-09352004000500020
Abstract: data from the brazilian mangalarga marchador breed association, including information on 292,012 animals borned from 1949 to 2000 were used to describe population structure. frequency tables, central tendency and variation measurements according to owner, breeder, type of registration (known and unknown pedigree), year and month of births, progeny number for stallions and mares were presented. a total of 72.6% of the animals originated from the southeast states of brazil. the maximum number of birth (6.7%) was observed in 1990 and approximately 90.0% of the births occurred from september to march. concerning progeny numbers, 73.6% of the 90,018 mares produced an average of 3.8 and a maximum of 22 offsprings. for the stallions these numbers were 26.2 and 1,322, respectively. the average generation interval was 8.9 years.
Composi??o química dos cascos de eqüinos das ra?as Pantaneira e Mangalarga Marchador
Faria, G.A.;Rezende, A.S.C.;Sampaio, I.B.M.;Lana, A.M.Q.;Moura, R.S.;Madureira, J.S.;Resende, M.C.;
Arquivo Brasileiro de Medicina Veterinária e Zootecnia , 2005, DOI: 10.1590/S0102-09352005000500016
Abstract: chemical composition (dry matter, crude protein, ether extract, ash, calcium, phosphorus, copper and zinc and amino acid profile) in black and non-pigmented hooves from non-lactating five-to ten-year-old pantaneira and mangalarga marchador mares raised in central and southeastern brazil was studied. in the pantaneira breed, phosphorus concentration was higher in non-pigmented than in black hooves, but hoof color did not affect any other composition variables. likewise, black versus non-pigmented hooves did not differ for any composition variable in the mangalarga marchador mares.
Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting
ANUNCIA??O, CARLOS EDUARDO;ASTOLFI-FILHO, SPARTACO;
Pesquisa Agropecuária Brasileira , 2000, DOI: 10.1590/S0100-204X2000001000012
Abstract: gc-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. in this study new dna sequences were isolated which could be used in paternity tests in horses. genomic dna from "mangalarga-marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. four clones (s01, s05, s07 and s09) selected from a genomic library screened with a (tg)n oligonucleotide showed similar hybridization profiles generating bands of dna-fingerprinting type. using these probes the individualization power obtained was 10-8, which is 105fold higher than that obtained with m13, another gc-rich type probe. all clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, gtttcatttattattctttggaagaaa, which was repeated 12, 18, 11 and 21 times in clones s01, s05, s07 and s09, respectively.
Heart rate of Mangalarga Marchador mares under marcha test and supplemented with chrome
Prates, Raquel Cheyne;Rezende, Heloisa Helena Capuano de;Lana, ?ngela Maria Quint?o;Borges, Iran;Moss, Patricia Carneiro Bernardes;Moura, Raquel Silva de;Rezende, Adalgiza Souza Carneiro de;
Revista Brasileira de Zootecnia , 2009, DOI: 10.1590/S1516-35982009000500019
Abstract: the objective of this experiment was to characterize the heart rate (hr) of twelve mangalarga marchador mares, before, during, and immediately after 5, 10, 15 and 20 minutes of marcha tests, evaluating the effect of chrome on cardiac performance. the mares were assigned into three groups distinguished by supplementation of 0, 5 and 10 mg of cr, respectively. the experiment was conducted in two phases, 24 and 6 days, respectively. the first phase included diet, cr and exercise adaptation and the second, three 50-minute marcha tests, every other day. before the tests, a heart rate monitor was adapted to check the hr. the assay was randomly conducted in split-splot arrangement, with four replications. mean comparisons were performed through minimal significative difference (msd) test and the time evaluation was performed through regression adjustment model. the results showed positive effect of cr on heart rate performance and animal return. chrome did not influence the heart rate during the marcha tests and the hr values characterized the marcha tests as sub maximal intensity exercise.
Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting
ANUNCIA??O CARLOS EDUARDO,ASTOLFI-FILHO SPARTACO
Pesquisa Agropecuária Brasileira , 2000,
Abstract: GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Page 1 /100
Display every page Item


Home
Copyright © 2008-2017 Open Access Library. All rights reserved.